VEGFB cloning plasmid

• Catalog number
  CSB-CL025834HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the VEGFB gene.
• Specifications
  Gene name: VEGFB; Gene ID: 7423; Accession number: BC008818; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 624; Sequence: atgagccctctgctccgccgcctgctgctcgccgcactcctgcagctggcccccgcccaggcccctgtctcccagcctgatgcccctggccaccagaggaaagtggtgtcatggatagatgtgtatactcgcgctacctgccagccccgggaggtggtggtgcccttgactgtggagctcatgggcaccgtggccaaacagctggtgcccagctgcgtgactgtgcagcgctgtggtggctgctgccctgacgatggcctggagtgtgtgcccactgggcagcaccaagtccggatgcagatcctcatgatccggtacccgagcagtcagctgggggagatgtccctggaagaacacagccagtgtgaatgcagacctaaaaaaaaggacagtgctgtgaagccagacagggctgccactccccaccaccgtccccagccccgttctgttccgggctgggactctgcccccggagcaccctccccagctgacatcacccatcccactccagccccaggcccctctgcccacgctgcacccagcaccaccagcgccctgacccccggacctgccgctgccgctgccgacgccgcagcttcctccgttgccaagggcggggcttag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  VEGFB   cloning  
• Gene symbol
  VEGFB
• Short name
  VEGFB cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  vascular endothelial growth factor B cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  vascular endothelial growth factor B, VEGFL and VRF, VEGFB and IDBG-53284 and ENSG00000173511 and 7423, protein heterodimerization activity, Extracellular, Vegfb and IDBG-137732 and ENSMUSG00000024962 and 22340, VEGFB and IDBG-643900 and ENSBTAG00000047567 and

Gene info

• Identity
  HGNC:12681
• Gene
  VEGFB
• Long gene name
  vascular endothelial growth factor B
• Synonyms gene
  • VRF
• Synonyms
  • VEGFL
• GenBank acession
  • BC008818
• Locus
  11q13.1
• Discovery year
  1996-10-26
• Entrez gene record
  7423
• Pubmed identfication
  • 8637916
  • 8919691
• RefSeq identity
  • NM_003377
• Classification
  • VEGF family
• VEGA ID
  OTTHUMG00000167813

Similar products