IRF6 cloning plasmid

• Catalog number
  CSB-CL011821HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the IRF6 gene.
• Specifications
  Gene name: IRF6; Gene ID: 3664; Accession number: BC014852; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1404; Sequence: atggccctccacccccgcagagtccggctaaagccctggctggtggcccaggtggatagtggcctctaccctgggctcatctggctacacagggactctaaacgcttccagattccctggaaacatgccacccggcatagccctcaacaagaagaggaaaataccatttttaaggcctgggctgtagagacagggaagtaccaggaaggggtggatgaccctgacccagctaaatggaaggcccagctgcgctgtgctctcaataagagcagagaattcaacctgatgtatgatggcaccaaggaggtgcccatgaacccagtgaagatatatcaagtgtgtgacatccctcagccccagggctcgatcattaacccaggatccacagggtctgctccctgggatgagaaggataatgatgtggatgaagaagatgaggaagatgagctggatcagtcgcagcaccatgttcccatccaggacaccttccccttcctgaacatcaatggttctcccatggcgccagccagtgtgggcaattgcagtgtgggcaactgcagcccggaggcagtgtggcccaaaactgaacccctggagatggaagtaccccaggcacctatacagcccttctatagctctccagaactgtggatcagctctctcccaatgactgacctggacatcaagtttcagtaccgtgggaaggagtacgggcagaccatgaccgtgagcaaccctcagggctgccgactcttctatggggacctgggtcccatgcctgaccaggaggagctctttggtcccgtcagcctggagcaggtcaaattcccaggtcctgagcatattaccaatgagaagcagaagctgttcactagcaagctgctggacgtcatggacagaggactgatcctggaggtcagcggtcatgccatttatgccatcaggctgtgccagtgcaaggtgtactggtctgggccatgtgccccatcacttgttgctcccaacctgattgagagacaaaagaaggtcaagctattttgtctggaaacattccttagcgatctcattgcccaccagaaaggacagatagagaagcagccaccgtttgagatctacttatgctttggggaagaatggccagatgggaaaccattggaaaggaaactcatcttggttcaggtcattccagtagtggctcggatgatctacgagatgttttctggtgatttcacacgatcctttgatagtggcagtgtccgcctgcagatctcaaccccagacatcaaggataacatcgttgctcagctgaagcagctgtaccgcatccttcaaacccaggagagctggcagcccatgcagcccacccccagcatgcaactgccccctgccctgcctccccagtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  IRF6   cloning  
• Gene symbol
  IRF6
• Short name
  IRF6 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  interferon regulatory factor 6 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  interferon regulatory factor 6, LPS and OFC6 and PIT and PPS and PPS1 and VWS and VWS1, IRF6 and IDBG-106452 and ENSG00000117595 and 3664, protein binding, nuclei, Irf6 and IDBG-209073 and ENSMUSG00000026638 and 54139, IRF6 and IDBG-638354 and ENSBTAG00000002849 and 614253

Gene info

• Identity
  HGNC:6121
• Gene
  IRF6
• Long gene name
  interferon regulatory factor 6
• Synonyms gene
  • VWS
  • LPS
• Synonyms gene name
  • Van der Woude syndrome
• Synonyms
  • OFC6
  • VWS1
• GenBank acession
  • AL022398
• Locus
  1q32.2
• Discovery year
  1997-10-16
• Entrez gene record
  3664
• Pubmed identfication
  • 12219090
• RefSeq identity
  • NM_006147
• Classification
  • Interferon regulatory factors
• VEGA ID
  OTTHUMG00000036521

Similar products