PPP2CB cloning plasmid

#

• Catalog number
  CSB-CL018560HU-10ug
• Price:

  Please ask

  Ask for price
• Size
  10ug

# #

• Description
  A cloning plasmid for the PPP2CB gene.
• Specifications
  Gene name: PPP2CB; Gene ID: 5516; Accession number: BC012022; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 930; Sequence: atggacgacaaggcgttcaccaaggagctggaccagtgggtcgagcagctgaacgagtgtaagcagctgaacgagaaccaagtgcggacgctgtgcgagaaggcaaaggaaattttaacaaaagaatcaaatgtgcaagaggttcgttgccctgttactgtctgtggagatgtgcatggtcaatttcatgatcttatggaactctttagaattggtggaaaatcaccggatacaaactacttattcatgggtgactatgtagacagaggatattattcagtggagactgtgactcttcttgtagcattaaaggtgcgttatccagaacgcattacaatattgagaggaaatcacgaaagccgacaaattacccaagtatatggcttttatgatgaatgtctgcgaaagtatgggaatgccaacgtttggaaatattttacagatctctttgattatcttccacttacagctttagtagatggacagatattctgcctccatggtggcctctctccatccatagacacactggatcatataagagccctggatcgtttacaggaagttccacatgagggcccaatgtgtgatctgttatggtcagatccagatgatcgtggtggatggggtatttcaccacgtggtgctggctacacatttggacaagacatttctgaaacctttaaccatgccaatggtctcacactggtttctcgtgcccaccagcttgtaatggagggatacaattggtgtcatgatcggaatgtggttaccattttcagtgcacccaattactgttatcgttgtgggaaccaggctgctatcatggaattagatgacactttaaaatattccttccttcaatttgacccagcgcctcgtcgtggtgagcctcatgttacacggcgcaccccagactacttcctataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

#

• Gene target
  PPP2CB   cloning  
• Gene symbol
  PPP2CB
• Short name
  PPP2CB cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  protein phosphatase 2, catalytic subunit, b isozyme cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  protein phosphatase 2, catalytic subunit, beta isozyme, PP2Abeta and PP2CB, PPP2CB and IDBG-15988 and ENSG00000104695 and 5516, metal ion binding, nuclei, Ppp2cb and IDBG-147600 and ENSMUSG00000009630 and 19053, PPP2CB and IDBG-628904 and ENSBTAG00000009245 and 524361

Gene info

• Identity
  HGNC:9300
• Gene
  PPP2CB
• Long gene name
  protein phosphatase 2 catalytic subunit beta
• Synonyms gene name
  • protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
  • protein phosphatase 2, catalytic subunit, beta isozyme
• Synonyms
  • PP2Abeta
• Synonyms name
  • protein phosphatase 2A catalytic subunit, beta isoform
• Locus
  8p12
• Discovery year
  1992-11-10
• Entrez gene record
  5516
• Pubmed identfication
  • 8383590
• RefSeq identity
  • NM_001009552
• Classification
  • STRIPAK complex
  • Protein phosphatase catalytic subunits
• VEGA ID
  OTTHUMG00000163949

Similar products