DNAJA3 cloning plasmid

• Catalog number
  CSB-CL836207HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the DNAJA3 gene.
• Specifications
  Gene name: DNAJA3; Gene ID: 9093; Accession number: BC011855; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1443; Sequence: atggctgcgcggtgctccacacgctggttgctggtggttgtggggaccccgcggctgccggctatatcgggtagaggggcccggccgcccagggagggcgtggtgggggcatggctgagccgcaagctgagcgtccccgcctttgcgtcttccctgacctcttgcggcccccgagcgctgctgacattgagacctggtgtcagcctcacaggaacaaaacattaccctttcatttgtactgcctccttccacacgagtgcccctttggccaaagaagattattatcagatattaggagtgcctcgaaatgccagccagaaagagatcaagaaagcctattatcagcttgccaagaagtatcaccctgacacaaataaggatgatcccaaagccaaggagaagttctcccagctggcagaagcctatgaggttttgagtgatgaggtgaagaggaagcagtacgatgcctacggctctgcaggcttcgatcctggggccagcggctcccagcatagctactggaagggaggccccactgtggaccccgaggagctgttcaggaagatctttggcgagttctcatcctcttcatttggagatttccagaccgtgtttgatcagcctcaggaatacttcatggagttgacattcaatcaagctgcaaagggggtcaacaaggagttcaccgtgaacatcatggacacgtgtgagcgctgcaacggcaaggggaacgagcccggcaccaaggtgcagcattgccactactgtggcggctccggcatggaaaccatcaacacaggcccttttgtgatgcgttccacgtgtaggagatgtggtggccgcggctccatcatcatatcgccctgtgtggtctgcaggggagcaggacaagccaagcagaaaaagcgagtgatgatccctgtgcctgcaggagtcgaggatggccagaccgtgaggatgcctgtgggaaaaagggaaattttcattacgttcagggtgcagaaaagccctgtgttccggagggacggcgcagacatccactccgacctctttatttctatagctcaggctcttcttgggggaacagccagagcccagggcctgtacgagacgatcaacgtgacgatcccccctgggactcagacagaccagaagattcggatgggtgggaaaggcatcccccggattaacagctacggctacggagaccactacatccacatcaagatacgagttccaaagaggctaacgagccggcagcagagcctgatcctgagctacgccgaggacgagacagatgtggaggggacggtgaacggcgtcaccctcaccagctctggtggcagcaccatggatagctccgcaggaagcaaggctaggcgtgaggctggggaggacgaggagggattcctttccaaacttaagaaaatgtttacctcatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  DNAJA3   cloning  
• Gene symbol
  DNAJA3
• Short name
  DNAJA3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  DnaJ (Hsp40) homolog, subfamily A, member 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  DnaJ (Hsp40) homolog, subfamily A, member 3, HCA57 and hTID-1 and TID1, DNAJA3 and IDBG-12754 and ENSG00000103423 and 9093, unfolded protein binding, nuclei, Dnaja3 and IDBG-129861 and ENSMUSG00000004069 and 83945, DNAJA3 and IDBG-636254 and ENSBTAG00000010013 and 513397

Gene info

• Identity
  HGNC:11808
• Gene
  DNAJA3
• Long gene name
  DnaJ heat shock protein family (Hsp40) member A3
• Synonyms gene
  • TID1
• Synonyms gene name
  • DnaJ (Hsp40) homolog, subfamily A, member 3
• Synonyms
  • hTid-1
• GenBank acession
  • AF061749
• Locus
  16p13.3
• Discovery year
  1999-01-29
• Entrez gene record
  9093
• Pubmed identfication
  • 9683573
• Classification
  • DNAJ (HSP40) heat shock proteins
• VEGA ID
  OTTHUMG00000129470

Similar products