AREG cloning plasmid

• Catalog number
  CSB-CL001986HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the AREG gene.
• Specifications
  Gene name: AREG; Gene ID: 374; Accession number: BC009799; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 759; Sequence: atgagagccccgctgctaccgccggcgccggtggtgctgtcgctcttgatactcggctcaggccattatgctgctggattggacctcaatgacacctactctgggaagcgtgaaccattttctggggaccacagtgctgatggatttgaggttacctcaagaagtgagatgtcttcagggagtgagatttcccctgtgagtgaaatgccttctagtagtgaaccgtcctcgggagccgactatgactactcagaagagtatgataacgaaccacaaatacctggctatattgtcgatgattcagtcagagttgaacaggtagttaagcccccccaaaacaagacggaaagtgaaaatacttcagataaacccaaaagaaagaaaaagggaggcaaaaatggaaaaaatagaagaaacagaaagaagaaaaatccatgtaatgcagaatttcaaaatttctgcattcacggagaatgcaaatatatagagcacctggaagcagtaacatgcaaatgtcagcaagaatatttcggtgaacggtgtggggaaaagtccatgaaaactcacagcatgattgacagtagtttatcaaaaattgcattagcagccatagctgcctttatgtctgctgtgatcctcacagctgttgctgttattacagtccagcttagaagacaatacgtcaggaaatatgaaggagaagctgaggaacgaaagaaacttcgacaagagaatggaaatgtacatgctatagcataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  AREG   cloning  
• Gene symbol
  AREG
• Short name
  AREG cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  amphiregulin cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  amphiregulin, AR and AREGB and CRDGF and SDGF, AREG and IDBG-24392 and ENSG00000109321 and 374, growth factor activity, nuclei, Areg and IDBG-179096 and ENSMUSG00000029378 and 11839, BT.28934 and IDBG-643038 and ENSBTAG00000018134 and 538751

Gene info

• Identity
  HGNC:651
• Gene
  AREG
• Long gene name
  amphiregulin
• Synonyms gene
  • SDGF
  • AREGB
• Synonyms gene name
  • schwannoma-derived growth factor
  • amphiregulin B
• GenBank acession
  • M30704
• Locus
  4q13.3
• Discovery year
  1989-05-19
• Entrez gene record
  374
• Classification
  • Receptor ligands
• VEGA ID
  OTTHUMG00000130006

Similar products