WWP2 cloning plasmid

• Catalog number
  CSB-CL026168HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the WWP2 gene.
• Specifications
  Gene name: WWP2; Gene ID: 11060; Accession number: BC000108; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1008; Sequence: atggcatctgccagctctagccgggcaggagtggccctgccttttgagaagtctcagctcactttgaaagtggtgtccgcaaagcccaaggtgcataatcgtcaacctcgaattaactcctacgtggaggtggcggtggatggactccccagtgagaccaagaagactgggaagcgcattgggagctctgagcttctctggaatgagatcatcattttgaatgtcacggcacagagtcatttagatttaaaggtctggagctgccataccttgagaaatgaactgctaggcaccgcatctgtcaacctctccaacgtcttgaagaacaatgggggcaaaatggagaacatgcagctgaccctgaacctgcagacggagaacaaaggcagcgttgtctcaggcggagagctgacaattttcctggacgggccaactgttgatctgggaaatgtgcctaatggcagtgccctgacagatggatcacagctgccttcgagagactccagtggaacagcagtagctccagagaaccggcaccagccccccagcacaaactgctttggtggaagatcccggacgcacagacattcgggtgcttcagccagaacaaccccagcaaccggcgagcaaagccccggtgctcggagccggcaccgccagcccgtcaagaactcaggccacagtggcttggccaatggcacagtgaatgatgaacccacaacagccactgatcccgaagaaccttccgttgttggtgtgacgtccccacctgctgcacccttgagtgtgaccccgaatcccaacacgacttctctccctgccccagccacaccggctgaaggagaggaacccagcacttcgggtacacagcagctcccagcggctgcccaggcccccgacgctctgcctgctggatgggaacagcgagagctgcccaacggacgtgtctattatgttgaccacaataccaagaccaccacctgggagcggccccttcctccagggtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  WWP2   cloning  
• Gene symbol
  WWP2
• Short name
  WWP2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  WW domain containing E3 ubiquitin protein ligase 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  WW domain containing E3 ubiquitin protein ligase 2, AIP2 and WWp2-like, WWP2 and IDBG-39538 and ENSG00000198373 and 11060, ligase activity, nuclei, Wwp2 and IDBG-190874 and ENSMUSG00000031930 and 66894, WWP2 and IDBG-634611 and ENSBTAG00000018421 and 512457

Gene info

• Identity
  HGNC:16804
• Gene
  WWP2
• Long gene name
  WW domain containing E3 ubiquitin protein ligase 2
• Synonyms
  • AIP2
• Synonyms name
  • atrophin-1-interacting protein 2
• GenBank acession
  • BC013645
• Locus
  16q22.1
• Discovery year
  2004-07-07
• Entrez gene record
  11060
• Pubmed identfication
  • 9169421
  • 12167593
• RefSeq identity
  • NM_007014
• Classification
  • HECT domain containing
  • MicroRNA protein coding host genes
  • C2 and WW domain containing
• VEGA ID
  OTTHUMG00000137573

Similar products