TM2D1 cloning plasmid

• Catalog number
  CSB-CL887145HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TM2D1 gene.
• Specifications
  Gene name: TM2D1; Gene ID: 83941; Accession number: BC029486; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 624; Sequence: atggcggccgcctggccgtctggtccgtctgctccggaggccgtgacggccagactcgttggtgtcctgtggttcgtctcagtcactacaggaccctggggggctgttgccacctccgccgggggcgaggagtcgcttaagtgcgaggacctcaaagtgggacaatatatttgtaaagatccaaaaataaatgacgctacgcaagaaccagttaactgtacaaactacacagctcatgtttcctgttttccagcacccaacataacttgtaaggattccagtggcaatgaaacacattttactgggaacgaagttggttttttcaagcccatatcttgccgaaatgtaaatggctattcctacaaagtggcagtcgcattgtctctttttcttggatggttgggagcagatcgattttaccttggataccctgctttgggtttgttaaagttttgcactgtagggttttgtggaattgggagcctaattgatttcattcttatttcaatgcagattgttggaccttcagatggaagtagttacattatagattactatggaaccagacttacaagactgagtattactaatgaaacatttagaaaaacgcaattatatccataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TM2D1   cloning  
• Gene symbol
  TM2D1
• Short name
  TM2D1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  TM2 domain containing 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  TM2 domain containing 1, TM2D1 and IDBG-99316 and ENSG00000162604 and 83941, G-protein coupled receptor activity, Plasma membranes, Tm2d1 and IDBG-165036 and ENSMUSG00000028563 and 94043, TM2D1 and IDBG-638671 and ENSBTAG00000017161 and 514249

Gene info

• Identity
  HGNC:24142
• Gene
  TM2D1
• Long gene name
  TM2 domain containing 1
• Synonyms
  • BBP
• Synonyms name
  • Beta-amyloid peptide binding protein
• GenBank acession
  • AF353990
• Locus
  1p31.3
• Discovery year
  2005-05-19
• Entrez gene record
  83941
• Pubmed identfication
  • 11278849
• RefSeq identity
  • NM_032027
• VEGA ID
  OTTHUMG00000008466

MeSH Data

• Name
  Electrophoresis, Gel, Two-Dimensional
• Concept
  Scope note: Electrophoresis in which a second perpendicular electrophoretic transport is performed on the separate components resulting from the first electrophoresis. This technique is usually performed on polyacrylamide gels.
• Tree numbers
  • E05.196.401.250
  • E05.301.300.230
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Similar products