GADD45A cloning plasmid
-
Catalog numberCSB-CL009161HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GADD45A gene.
-
SpecificationsGene name: GADD45A; Gene ID: 1647; Accession number: BC011757; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 498; Sequence: atgactttggaggaattctcggctggagagcagaagaccgaaaggatggataaggtgggggatgccctggaggaagtgctcagcaaagccctgagtcagcgcacgatcactgtcggggtgtacgaagcggccaagctgctcaacgtcgaccccgataacgtggtgttgtgcctgctggcggcggacgaggacgacgacagagatgtggctctgcagatccacttcaccctgatccaggcgttttgctgcgagaacgacatcaacatcctgcgcgtcagcaacccgggccggctggcggagctcctgctcttggagaccgacgctggccccgcggcgagcgagggcgccgagcagcccccggacctgcactgcgtgctggtgacgaatccacattcatctcaatggaaggatcctgccttaagtcaacttatttgtttttgccgggaaagtcgctacatggatcaatgggttccagtgattaatctccctgaacggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGADD45A
-
Short nameGADD45A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namegrowth arrest and Desoxyribonucleic acid-damage-inducible, a cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetgrowth arrest and DNA-damage-inducible, alpha, DDIT1 and GADD45, GADD45A and IDBG-99580 and ENSG00000116717 and 1647, protein binding, nuclei, Gadd45a and IDBG-153723 and ENSMUSG00000036390 and 13197, GADD45A and IDBG-638096 and ENSBTAG00000013860 and 505463
-
Gene info
-
Identity
-
Gene
-
Long gene namegrowth arrest and DNA damage inducible alpha
-
Synonyms gene
-
Synonyms gene name
- growth arrest and DNA-damage-inducible, alpha
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1991-08-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID