TIMP2 cloning plasmid

• Catalog number
  CSB-CL023561HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TIMP2 gene.
• Specifications
  Gene name: TIMP2; Gene ID: 7077; Accession number: BC052605; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 663; Sequence: atgggcgccgcggcccgcaccctgcggctggcgctcggcctcctgctgctggcgacgctgcttcgcccggccgacgcctgcagctgctccccggtgcacccgcaacaggcgttttgcaatgcagatgtagtgatcagggccaaagcggtcagtgagaaggaagtggactctggaaacgacatttatggcaaccctatcaagaggatccagtatgagatcaagcagataaagatgttcaaagggcctgagaaggatatagagtttatctacacggccccctcctcggcagtgtgtggggtctcgctggacgttggaggaaagaaggaatatctcattgcaggaaaggccgagggggacggcaagatgcacatcaccctctgtgacttcatcgtgccctgggacaccctgagcaccacccagaagaagagcctgaaccacaggtaccagatgggctgcgagtgcaagatcacgcgctgccccatgatcccgtgctacatctcctccccggacgagtgcctctggatggactgggtcacagagaagaacatcaacgggcaccaggccaagttcttcgcctgcatcaagagaagtgacggctcctgtgcgtggtaccgcggcgcggcgccccccaagcaggagtttctcgacatcgaggacccataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TIMP2   cloning  
• Gene symbol
  TIMP2
• Short name
  TIMP2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  TIMP metallopeptidase inhibitor 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  TIMP metallopeptidase inhibitor 2, CSC-21K and DDC8, TIMP2 and IDBG-70963 and ENSG00000035862 and 7077, metal ion binding, Extracellular, Timp2 and IDBG-214632 and ENSMUSG00000017466 and 21858, BT.52974 and IDBG-642791 and ENSBTAG00000010899 and 282093

Gene info

• Identity
  HGNC:11821
• Gene
  TIMP2
• Long gene name
  TIMP metallopeptidase inhibitor 2
• Synonyms gene name
  • tissue inhibitor of metalloproteinase 2
• Synonyms
  • CSC-21K
• Locus
  17q25.3
• Discovery year
  1992-06-18
• Entrez gene record
  7077
• Pubmed identfication
  • 1427908
• RefSeq identity
  • NM_003255
• Classification
  • Tissue inhibitor of metallopeptidases
• VEGA ID
  OTTHUMG00000154517

Similar products