AKT2 cloning plasmid

• Catalog number
  CSB-CL001555HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the AKT2 gene.
• Specifications
  Gene name: AKT2; Gene ID: 208; Accession number: BC063421; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 444; Sequence: atgaggtgtctgtcatcaaagaaggctggctccacaagcgtggtgaaatacatcaagacctggaggccacggtacttcctgctgaagagcgacggctccttcattgggtacaaggagaggcccgaggcccctgatcagactctaccccccttaaacaacttctccgtagcagaatgccagctgatgaagaccgagaggccgcgacccaacacctttgtcatacgctgcctgcagtggaccacagtcatcgagaggaccttccacgtggattctccagacgagagggaggagtggatgcgggccatccagatggtcgccaacagcctccagcctcacctttgtgcccagactcgcatttggaagactccacctcccgcccaggcctgggctgttgggcggttggagattcaggttttaatccacacaagccccagtgaggggtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  AKT2   cloning  
• Gene symbol
  AKT2
• Short name
  AKT2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  v-akt murine thymoma viral oncogene homolog 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  v-akt murine thymoma viral oncogene homolog 2, HIHGHH and PKBB and PKBBETA and PRKBB and RAC-BETA, AKT2 and IDBG-51270 and ENSG00000105221 and 208, transferase activity, nuclei, Akt2 and IDBG-161456 and ENSMUSG00000004056 and 11652, AKT2 and IDBG-637808 and ENSBTAG00000001400 and 534923

Gene info

• Identity
  HGNC:392
• Gene
  AKT2
• Long gene name
  AKT serine/threonine kinase 2
• Synonyms gene name
  • v-akt murine thymoma viral oncogene homolog 2
• Synonyms
  • PKBβ
• GenBank acession
  • M77198
• Locus
  19q13.2
• Discovery year
  1992-11-05
• Entrez gene record
  208
• Pubmed identfication
  • 1409633
• RefSeq identity
  • NM_001626
• Classification
  • AKT kinases
  • Pleckstrin homology domain containing
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000137375
• Locus Specific Databases
  • LRG_1391

Similar products