RAB35 cloning plasmid
-
Catalog numberCSB-CL614887HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAB35 gene.
-
SpecificationsGene name: RAB35; Gene ID: 11021; Accession number: BC015931; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 606; Sequence: atggcccgggactacgaccacctcttcaagctgctcatcatcggcgacagcggtgtgggcaagagcagtttactgttgcgttttgcagacaacactttctcaggcagctacatcaccacgatcggagtggatttcaagatccggaccgtggagatcaacggggagaaggtgaagctgcagatctgggacacagcggggcaggagcgcttccgcaccatcacctccacgtattatcgggggacccacggggtcattgtggtttacgacgtcaccagtgccgagtcctttgtcaacgtcaagcggtggcttcacgaaatcaaccagaactgtgatgatgtgtgccgaatattagtgggtaataagaatgacgaccctgagcggaaggtggtggagacggaagatgcctacaaattcgccgggcagatgggcatccagttgttcgagaccagcgccaaggagaatgtcaacgtggaagagatgttcaactgcatcacggagctggtcctccgagcaaagaaagacaacctggcaaaacagcagcagcaacaacagaacgatgtggtgaagctcacgaagaacagtaaacgaaagaaacgctgctgctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAB35
-
Short nameRAB35 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRAB35, member RAS oncogene family cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRAB35, member RAS oncogene family, H-ray and RAB1C and RAY, RAB35 and IDBG-60134 and ENSG00000111737 and 11021, phosphatidylinositol-4, nuclei, Rab35 and IDBG-194257 and ENSMUSG00000029518 and 77407, BT.26843 and IDBG-634483 and ENSBTAG00000022044 and 614521
-
Gene info
-
Identity
-
Gene
-
Long gene nameRAB35, member RAS oncogene family
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-09-29
-
Entrez gene record
-
Classification
- RAB, member RAS oncogene GTPases
-
VEGA ID