CER1 cloning plasmid

• Catalog number
  CSB-CL005254HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CER1 gene.
• Specifications
  Gene name: CER1; Gene ID: 9350; Accession number: BC069503; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 798; Sequence: atgcatctcctcttatttcagctgctggtactcctgcctctaggaaagaccacatggcaccaggatggccgccagaatcagagttctctttcccccgtactcctgccaaggaatcaaagagagcttcccacaggcaaccatgaggaagctgaggagaagccagatctgcttgtcgcagtgccacaccttgtaggcaccagccctgcaggggaaggccagaggcagagagagaagatgctgtccagatttggcaggttctggaagaagcctgagagagaaatgcatccatccagggactcagatagtgagcccttcccacctgggacccagtccctcatccagccgatagatggaatgaaaatggagaaatctcctcttcgggaagaagccaagaaattctggcaccacttcatgttcagaaaaactccggcttctcagggggtcatcttgcccatcaaaagccatgaagtacattgggagacctgcaggacagtgcccttcagccagactataacccacgaaggctgtgaaaaaatagttgttcagaacaacctttgctttgggaaatgcgggtctgttcattttcctggagccgcgcagcactcccatacctcctgctctcactgtttgcctgccaagttcaccacgatgcacttgccactgaactgcactgaactttcctccgtgatcaaggtggtgatgctggtggaggagtgccagtgcaaggtgaagacggagcatgaagatggacacatcctacatgctggctcccaggattcctttatcccaggagtttga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CER1   cloning  
• Gene symbol
  CER1, C3CER1
• Short name
  CER1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), DAND4, CER1 and IDBG-50819 and ENSG00000147869 and 9350, protein homodimerization activity, Extracellular, Cer1 and IDBG-159643 and ENSMUSG00000038192 and 12622, CER1 and IDBG-630780 and ENSBTAG00000020140 and 508019

Gene info

• Identity
  HGNC:1862
• Gene
  CER1
• Long gene name
  cerberus 1, DAN family BMP antagonist
• Synonyms gene name
  • cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)
  • cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
• Synonyms
  • DAND4
• GenBank acession
  • AF090189
• Locus
  9p22.3
• Discovery year
  1998-09-25
• Entrez gene record
  9350
• Pubmed identfication
  • 10049596
• RefSeq identity
  • NM_005454
• Classification
  • DAN family
• VEGA ID
  OTTHUMG00000021022

Gene info

• Identity
  HGNC:1320
• Gene
  C3CER1
• Long gene name
  chromosome 3 common eliminated region 1
• Synonyms
  • CER1
• Locus
  3p22-p21.2
• Discovery year
  1999-08-05
• Entrez gene record
  23739
• Pubmed identfication
  • 9408748
  • 10610706
  • 11896456

Similar products