ERCC1 cloning plasmid
-
Catalog numberCSB-CL007769HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ERCC1 gene.
-
SpecificationsGene name: ERCC1; Gene ID: 2067; Accession number: BC008930; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 894; Sequence: atggaccctgggaaggacaaagagggggtgccccagccctcagggccgccagcaaggaagaaatttgtgatacccctcgacgaggatgaggtccctcctggagtggccaagcccttattccgatctacacagagccttcccactgtggacacctcggcccaggcggcccctcagacctacgccgaatatgccatctcacagcctctggaaggggctggggccacgtgccccacagggtcagagcccctggcaggagagacgcccaaccaggccctgaaacccggggcaaaatccaacagcatcattgtgagccctcggcagaggggcaatcccgtactgaagttcgtgcgcaacgtgccctgggaatttggcgacgtaattcccgactatgtgctgggccagagcacctgtgccctgttcctcagcctccgctaccacaacctgcacccagactacatccatgggcggctgcagagcctggggaagaacttcgccttgcgggtcctgcttgtccaggtggatgtgaaagatccccagcaggccctcaaggagctggctaagatgtgtatcctggccgactgcacattgatcctcgcctggagccccgaggaagctgggcggtacctggagacctacaaggcctatgagcagaaaccagcggacctcctgatggagaagctagagcaggacttcgtctcccgggtgactgaatgtctgaccaccgtgaagtcagtcaacaaaacggacagtcagaccctcctgaccacatttggatctctggaacagctcatcgccgcatcaagagaagatctggccttatgcccaggcctgggccctcagaaagcccggaggctgtttgatgtcctgcacgagcccttcttgaaagtaccctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolERCC1
-
Short nameERCC1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameexcision repair cross-complementing rodent repair deficiency, complementation family 1 (includes overlapping antisense sequence) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetexcision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence), COFS4 and RAD10 and UV20, ERCC1 and IDBG-57509 and ENSG00000012061 and 2067, structure-specific DNA binding, nuclei, Ercc1 and IDBG-150201 and ENSMUSG00000003549 and 13870, ERCC1 and IDBG-639466 and ENSBTAG00000017355 and 615637
-
Gene info
-
Identity
-
Gene
-
Long gene nameERCC excision repair 1, endonuclease non-catalytic subunit
-
Synonyms gene name
- excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
- excision repair cross-complementation group 1
-
Synonyms
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- ERCC excision repair associated
-
VEGA ID
-
Locus Specific Databases