C1QTNF3 cloning plasmid
-
Catalog numberCSB-CL883621HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the C1QTNF3 gene.
-
SpecificationsGene name: C1QTNF3; Gene ID: 114899; Accession number: BC016021; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 381; Sequence: atggcttctctggcaacccacttcagcaatcagaacagtgggattatcttcagcagtgttgagaccaacattggaaacttctttgatgtcatgactggtagatttggggccccagtatcaggtgtgtatttcttcaccttcagcatgatgaagcatgaggatgttgaggaagtgtatgtgtaccttatgcacaatggcaacacagtcttcagcatgtacagctatgaaatgaagggcaaatcagatacatccagcaatcatgctgtgctgaagctagccgaaggggatgaggtttggctgcgaatgggcaatggcgctctccatggggaccaccaacgcttctccacctttgcaggattcctgctctttgaaactaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolC1QTNF3-AMACR, C1QTNF3
-
Short nameC1QTNF3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameC1q and tumor necrosis factor related protein 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetC1q and tumor necrosis factor related protein 3, C1QTNF3 and IDBG-15015 and ENSG00000082196 and 114899, protein binding, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene nameC1QTNF3-AMACR readthrough (NMD candidate)
-
Locus
-
Discovery year2013-09-30
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameC1q and TNF related 3
-
Synonyms gene name
- C1q and tumor necrosis factor related protein 3
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-10-02
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C1q and TNF related
-
VEGA ID