C1QA cloning plasmid
#
-
Catalog numberCSB-CL003637HU-10ug
-
Price:
-
Size10ug
-
-
DescriptionA cloning plasmid for the C1QA gene.
-
SpecificationsGene name: C1QA; Gene ID: 712; Accession number: BC030153; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 738; Sequence: atggagggtccccggggatggctggtgctctgtgtgctggccatatcgctggcctctatggtgaccgaggacttgtgccgagcaccagacgggaagaaaggggaggcaggaagacctggcagacgggggcggccaggcctcaagggggagcaaggggagccgggggcccctggcatccggacaggcatccaaggccttaaaggagaccagggggaacctgggccctctggaaaccccggcaaggtgggctacccagggcccagcggccccctcggggcccgtggcatcccgggaattaaaggcaccaagggcagcccaggaaacatcaaggaccagccgaggccagccttctccgccattcggcggaaccccccaatggggggcaacgtggtcatcttcgacacggtcatcaccaaccaggaagaaccgtaccagaaccactccggccgattcgtctgcactgtacccggctactactacttcaccttccaggtgctgtcccagtgggaaatctgcctgtccatcgtctcctcctcaaggggccaggtccgacgctccctgggcttctgtgacaccaccaacaaggggctcttccaggtggtgtcagggggcatggtgcttcagctgcagcagggtgaccaggtctgggttgaaaaagaccccaaaaagggtcacatttaccagggctctgaggccgacagcgtcttcagcggcttcctcatcttcccatctgcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolC1QA
-
Short nameC1QA cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecomplement component 1, q subcomponent, A chain cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcomplement component 1, q subcomponent, A chain, C1QA and IDBG-93718 and ENSG00000173372 and 712, protein binding, Extracellular, C1qa and IDBG-198277 and ENSMUSG00000036887 and 12259, C1QA and IDBG-645509 and ENSBTAG00000007153 and 534961
-
Gene info
-
Identity
-
Gene
-
Long gene namecomplement C1q A chain
-
Synonyms gene name
- complement component 1, q subcomponent, alpha polypeptide
- complement component 1, q subcomponent, A chain
- complement C1q chain A
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Complement system activation components
- C1q domain containing
-
VEGA ID
-
Locus Specific Databases