TLX2 cloning plasmid

• Catalog number
  CSB-CL023610HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TLX2 gene.
• Specifications
  Gene name: TLX2; Gene ID: 3196; Accession number: BC006356; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 855; Sequence: atggagccggggatgctgggtccacacaacctcccacaccacgagccaatcagcttcggcatcgatcagatcctgagcggccccgaaaccccagggggcggtctaggcctgggtcgcgggggccagggtcatggggagaatggggcgttctcgggtggataccacggagcctcgggctacggtcccgccggctcacttgccccgctgcccggcagctccggagtgggcccaggcggcgtgatccgcgtccctgcgcaccgcccgctgcctgtgccgccgcccgctgggggggcgcctgcagtgcctgggccctcgggtttgggcggcgccggaggcctagcgggactcaccttcccctggatggacagcggccgccgctttgccaaggaccggctcacggctgcgctctcgcccttctctgggacgcgccgcataggccacccctaccaaaaccggacccctccgaagcggaagaagccgcgcacgtccttctcccgctcacaggtgctggagttggagcggcgcttcctgcgccagaagtacctggcctctgcggagagggcggcgctggccaaggccttgcgcatgaccgacgcacaggtcaaaacgtggttccagaaccgacgcaccaagtggcggcgccagacggcggaggagcgcgaggccgagcggcaccgcgcgggccggctgctcctgcatctgcagcaggacgcgttgccacggccgctgcggccgccgctgcccccggaccctctctgcctgcacaactcgtcgctcttcgcgctgcagaacctgcagccctgggccgaggacaacaaagtggcttcagtgtccgggctcgcctcggtggtgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TLX2   cloning  
• Gene symbol
  TLX2
• Short name
  TLX2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  T-cellular leukemia homeobox 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  T-cell leukemia homeobox 2, HOX11L1 and NCX, TLX2 and IDBG-57593 and ENSG00000115297 and 3196, sequence-specific DNA binding, nuclei, Tlx2 and IDBG-159907 and ENSMUSG00000068327 and 21909, TLX2 and IDBG-631278 and ENSBTAG00000016607 and 539041

Gene info

• Identity
  HGNC:5057
• Gene
  TLX2
• Long gene name
  T cell leukemia homeobox 2
• Synonyms gene
  • HOX11L1
• Synonyms gene name
  • homeo box 11-like 1
  • T-cell leukemia, homeobox 2
  • T-cell leukemia homeobox 2
• Synonyms
  • Enx
  • NCX
• GenBank acession
  • AJ002607
• Locus
  2p13.1
• Discovery year
  1998-08-04
• Entrez gene record
  3196
• Pubmed identfication
  • 10343123
• Classification
  • NKL subclass homeoboxes and pseudogenes
• VEGA ID
  OTTHUMG00000129960

Similar products