POMP cloning plasmid
-
Catalog numberCSB-CL018365HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the POMP gene.
-
SpecificationsGene name: POMP; Gene ID: 51371; Accession number: BC003390; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 426; Sequence: atgaatgccagaggacttggatctgagctaaaggacagtattccagttactgaactttcagcaagtggaccttttgaaagtcatgatcttcttcggaaaggtttttcttgtgtgaaaaatgaacttttgcctagtcatccccttgaattatcagaaaaaaatttccagctcaaccaagataaaatgaatttttccacactgagaaacattcagggtctatttgctccgctaaaattacagatggaattcaaggcagtgcagcaggttcagcgtcttccatttctttcaagctcaaatctttcactggatgttttgaggggtaatgatgagactattggatttgaggatattcttaatgatccatcacaaagcgaagtcatgggagagccacacttgatggtggaatataaacttggtttactgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPOMP, NT5C3A
-
Short namePOMP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome maturation protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome maturation protein, POMP and IDBG-20205 and ENSG00000132963 and 51371, protein binding, nuclei, Pomp and IDBG-209157 and ENSMUSG00000029649 and 66537, POMP and IDBG-630638 and ENSBTAG00000014024 and 510314
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome maturation protein
-
Synonyms gene
-
Synonyms gene name
- chromosome 13 open reading frame 12
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2003-01-29
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene name5'-nucleotidase, cytosolic IIIA
-
Synonyms gene
-
Synonyms gene name
- 5'-nucleotidase, cytosolic III
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2002-04-18
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- 5'-nucleotidases
-
VEGA ID