CD46 cloning plasmid

• Catalog number
  CSB-CL004939HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CD46 gene.
• Specifications
  Gene name: CD46; Gene ID: 4179; Accession number: BC030594; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1155; Sequence: atggagcctcccggccgccgcgagtgtccctttccttcctggcgctttcctgggttgcttctggcggccatggtgttgctgctgtactccttctccgatgcctgtgaggagccaccaacatttgaagctatggagctcattggtaaaccaaaaccctactatgagattggtgaacgagtagattataagtgtaaaaaaggatacttctatatacctcctcttgccacccatactatttgtgatcggaatcatacatggctacctgtctcagatgacgcctgttatagagaaacatgtccatatatacgggatcctttaaatggccaagcagtccctgcaaatgggacttacgagtttggttatcagatgcactttatttgtaatgagggttattacttaattggtgaagaaattctatattgtgaacttaaaggatcagtagcaatttggagcggtaagcccccaatatgtgaaaaggttttgtgtacaccacctccaaaaataaaaaatggaaaacacacctttagtgaagtagaagtatttgagtatcttgatgcagtaacttatagttgtgatcctgcacctggaccagatccattttcacttattggagagagcacgatttattgtggtgacaattcagtgtggagtcgtgctgctccagagtgtaaagtggtcaaatgtcgatttccagtagtcgaaaatggaaaacagatatcaggatttggaaaaaaattttactacaaagcaacagttatgtttgaatgcgataagggtttttacctcgatggcagcgacacaattgtctgtgacagtaacagtacttgggatcccccagttccaaagtgtcttaaagtgtcgacttcttccactacaaaatctccagcgtccagtgcctcaggtcctaggcctacttacaagcctccagtctcaaattatccaggatatcctaaacctgaggaaggaatacttgacagtttggatgtttgggtcattgctgtgattgttattgccatagttgttggagttgcagtaatttgtgttgtcccgtacagatatcttcaaaggaggaagaagaaagggaaagcagatggtggagctgaatatgccacttaccagactaaatcaaccactccagcagagcagagaggctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CD46   cloning  
• Gene symbol
  CD46
• Short name
  CD46 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  CD46 molecule, complement regulatory protein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CD46 molecule, complement regulatory protein, AHUS2 and MCP and MIC10 and TLX and TRA2.10, CD46 and IDBG-106372 and ENSG00000117335 and 4179, cadherin binding, Cell surfaces, Cd46 and IDBG-209330 and ENSMUSG00000016493 and 17221, BT.68611 and IDBG-638462 and ENSBTAG00000005397 and 280851

Gene info

• Identity
  HGNC:6953
• Gene
  CD46
• Long gene name
  CD46 molecule
• Synonyms gene
  • MIC10
  • MCP
• Synonyms gene name
  • antigen identified by monoclonal antibody TRA-2-10
  • membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)
  • CD46 antigen, complement regulatory protein
  • CD46 molecule, complement regulatory protein
• Synonyms
  • TRA2.10
  • MGC26544
  • TLX
• GenBank acession
  • BC030594
• Locus
  1q32.2
• Discovery year
  1988-08-31
• Entrez gene record
  4179
• Pubmed identfication
  • 7929741
• RefSeq identity
  • NM_172361
• Classification
  • Sushi domain containing
  • Complement system regulators and receptors
  • CD molecules
• VEGA ID
  OTTHUMG00000036397
• Locus Specific Databases
  • LRG_155

Similar products