RAB7A cloning plasmid
-
Catalog numberCSB-CL019219HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAB7A gene.
-
SpecificationsGene name: RAB7A; Gene ID: 7879; Accession number: BC013728; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 696; Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtggagcaggcgttccagacgattgcacggaatgcacttaagcaggaaacggaggtggagctgtacaacgaatttcctgaacctatcaaactggacaagaatgaccgggccaaggcctcggcagaaagctgcagttgctgagggggcagtgagagttgagcacagagtccttcacaaaccaagaacacacgtaggccttcaacacaattcccctctcctcttccaaacaaaacatacattgatctctcacatccagctgccaaaagaaaaccccatcaaacacagttacaccccacatatctctcacacacacacacacacgcacacacacacacacagatctgacgtaatcaaactccagcccttgcccgtgatggctccttggggtctgcctgcccacccacatgagcccgcgagtatggcagcaggacaagccagcggtggaagtcattctgatatggagttggcattggaagcttattctttttgttcactggagagagagagaactgtttacagttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAB7A
-
Short nameRAB7A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRAB7A, member RAS oncogene family cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRAB7A, member RAS oncogene family, PRO2706 and RAB7, RAB7A and IDBG-55277 and ENSG00000075785 and 7879, Rac GTPase binding, nuclei, Rab7 and IDBG-253533 and ENSMUSG00000079477 and 19349, BT.41314 and IDBG-646498 and ENSBTAG00000010193 and 509970
-
Gene info
-
Identity
-
Gene
-
Long gene nameRAB7A, member RAS oncogene family
-
Synonyms gene
-
Synonyms gene name
- RAB7, member RAS oncogene family
- Charcot-Marie-Tooth neuropathy 2B
-
GenBank acession
-
Locus
-
Discovery year1999-03-24
-
Entrez gene record
-
Pubmed identfication
-
Classification
- RAB, member RAS oncogene GTPases
-
VEGA ID
-
Locus Specific Databases