PITX1 cloning plasmid
-
Catalog numberCSB-CL018042HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PITX1 gene.
-
SpecificationsGene name: PITX1; Gene ID: 5307; Accession number: BC009412; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 945; Sequence: atggacgccttcaaggggggcatgagcctggagcggctgccggaggggctccggccgccgccgccgccaccccatgacatggggcccgccttccacctggcccggcccgccgacccccgcgagccgctcgagaactccgccagcgagtcgtctgacacggagctgccagagaaggagcgcggcggggaacccaaggggcccgaggacagtggtgcgggaggcacgggctgcggcggcgcagacgacccagccaagaagaagaagcagcggcggcaacgtacgcacttcacaagccagcagttgcaagagctagaggccacgttccagaggaaccgctaccccgacatgagcatgagggaggagatcgccgtgtggaccaacctcaccgagccgcgcgtgcgggtctggttcaagaaccggcgagccaagtggcgtaagcgcgagcgtaaccagcagctggacctgtgcaagggtggctacgtgccgcagttcagcggcctagtgcagccctacgaggacgtgtacgccgccggctactcctacaacaactgggccgccaagagcctggcgccagcgccgctctccaccaagagcttcaccttcttcaactccatgagcccgctgtcgtcgcagtccatgttctcagcacccagctccatctcctccatgaccatgccgtccagcatgggcccaggcgccgtgcctggcatgcccaactcgggcctcaacaacatcaacaacctcaccggctcctcgctcaactcggccatgtcgccgggcgcttgcccgtacggcactcccgcctcgccctacagcgtctaccgggacacgtgcaactcgagcctagccagcctgcggctcaagtccaaacagcactcgtcgtttggctacggcggcctgcagggcccggcctcgggcctcaacgcgtgccagtacaacagctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPITX1-AS1, PITX1
-
Short namePITX1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepaired-like homeodomain 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpaired-like homeodomain 1, BFT and CCF and LBNBG and POTX and PTX1, PITX1 and IDBG-45420 and ENSG00000069011 and 5307, sequence-specific DNA binding, nuclei, Pitx1 and IDBG-156932 and ENSMUSG00000021506 and 18740, PITX1 and IDBG-645841 and ENSBTAG00000004602 and 508754
-
Gene info
-
Identity
-
Gene
-
Long gene namePITX1 antisense RNA 1
-
Synonyms gene
-
Synonyms gene name
- chromosome 5 open reading frame 66
- chromosome 5 putative open reading frame 66
-
Locus
-
Discovery year2013-11-06
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namepaired like homeodomain 1
-
Synonyms gene
-
Synonyms gene name
- paired-like homeodomain transcription factor 1
- paired-like homeodomain 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-02-27
-
Entrez gene record
-
Pubmed identfication
-
Classification
- PRD class homeoboxes and pseudogenes
-
VEGA ID