NGF cloning plasmid
-
Catalog numberCSB-CL015779HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NGF gene.
-
SpecificationsGene name: NGF; Gene ID: 4803; Accession number: BC126148; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 726; Sequence: atgtccatgttgttctacactctgatcacagcttttctgatcggcatacaggcggaaccacactcagagagcaatgtccctgcaggacacaccatcccccaagtccactggactaaacttcagcattcccttgacactgcccttcgcagagcccgcagcgccccggcagcggcgatagctgcacgcgtggcggggcagacccgcaacattactgtggaccccaggctgtttaaaaagcggcgactccgttcaccccgtgtgctgtttagcacccagcctccccgtgaagctgcagacactcaggatctggacttcgaggtcggtggtgctgcccccttcaacaggactcacaggagcaagcggtcatcatcccatcccatcttccacaggggcgaattctcggtgtgtgacagtgtcagcgtgtgggttggggataagaccaccgccacagacatcaagggcaaggaggtgatggtgttgggagaggtgaacattaacaacagtgtattcaaacagtacttttttgagaccaagtgccgggacccaaatcccgttgacagcgggtgccggggcattgactcaaagcactggaactcatattgtaccacgactcacacctttgtcaaggcgctgaccatggatggcaagcaggctgcctggcggtttatccggatagatacggcctgtgtgtgtgtgctcagcaggaaggctgtgagaagagcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNGF, NGF-AS1
-
Short nameNGF cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namenerve growth factor (beta polypeptide) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetnerve growth factor (beta polypeptide), Beta-NGF and HSAN5 and NGFB, NGF and IDBG-101347 and ENSG00000134259 and 4803, growth factor activity, Extracellular, Ngf and IDBG-180362 and ENSMUSG00000027859 and 18049, NGF and IDBG-648895 and ENSBTAG00000007446 and 281350
-
Gene info
-
Identity
-
Gene
-
Long gene namenerve growth factor
-
Synonyms gene
-
Synonyms gene name
- nerve growth factor (beta polypeptide)
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
RefSeq identity
-
Classification
- Neurotrophins
-
VEGA ID
-
Locus Specific Databases
Gene info
-
Identity
-
Gene
-
Long gene nameNGF antisense RNA 1
-
Synonyms
-
Locus
-
Discovery year2018-06-08
-
Pubmed identfication
-
Classification
- Antisense RNAs