PPP1R12B cloning plasmid
-
Catalog numberCSB-CL018512HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PPP1R12B gene.
-
SpecificationsGene name: PPP1R12B; Gene ID: 4660; Accession number: BC071166; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 429; Sequence: atggcggaactggagcacctaggagggaagcgggcagagtcggcgcgaatgcggcgggcagagcagcttcggcgctggcggggctcgctgacagagcaggagcctgcggagcgacgaggcgcggggcggcagccgctgaccaggcgcgggagccccagggtccgcttcgaggacggtgctgtctttctggccgcctgctctagcggggacaccgacgaggtgagaaagcttctggcaagaggtgctgatatcaacacggtcaacgtggacggcttgacagccctgcaccaggcatgtattgatgaaaatttggacatggtgaagtttctggtggagaacagagccaatgtaaaccagcaagacaacgagggctggacaccccttcatgcagcagcttcctgtggctatctcaacatagcagagagttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPPP1R12B
-
Short namePPP1R12B cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namePPP1R12B cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameprotein phosphatase 1 regulatory subunit 12B
-
Synonyms gene
-
Synonyms gene name
- protein phosphatase 1, regulatory (inhibitor) subunit 12B
- protein phosphatase 1, regulatory subunit 12B
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-07-13
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Myosin phosphatase targeting family
- Protein phosphatase 1 regulatory subunits
- Ankyrin repeat domain containing
-
VEGA ID