IL4 cloning plasmid

  • Catalog number
    CSB-CL011659HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the IL4 gene.
  • Specifications
    Gene name: IL4; Gene ID: 3565; Accession number: BC067514; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 462; Sequence: atgggtctcacctcccaactgcttccccctctgttcttcctgctagcatgtgccggcaactttgtccacggacacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaattcctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Gene
    Interleukin 4 (IL4) is a cytokine that induces differentiation of naive helper T cells (Th0 cells) to Th2 cells. It is used for dendritic and T cell therapy. Upon activation by IL-4, Th2 cells subsequently produce additional IL-4 in a positive feedback loop. The cell that initially produces IL-4, thus inducing Th0 differentiation, has not been identified, but recent studies suggest that basophils may be the effector cell. It is closely related and has functions similar to Interleukin 13. Recombinant, GMP rec. E. coli interleukin-4 for cell culture supplied by GENTAUR. Free samples on request.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    IL4   cloning  
  • Gene symbol
    IL4
  • Short name
    IL4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    interleukin 4 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    interleukin 4, BCGF-1 and BCGF1 and BSF-1 and BSF1 and IL-4, IL4 and IDBG-42701 and ENSG00000113520 and 3565, growth factor activity, Extracellular, Il4 and IDBG-172024 and ENSMUSG00000000869 and 16189, IL4 and IDBG-644671 and ENSBTAG00000015957 and 280824
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee