CCL19 cloning plasmid
-
Catalog numberCSB-CL859522HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCL19 gene.
-
SpecificationsGene name: CCL19; Gene ID: 6363; Accession number: BC027968; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 297; Sequence: atggccctgctactggccctcagcctgctggttctctggacttccccagccccaactctgagtggcaccaatgatgctgaagactgctgcctgtctgtgacccagaaacccatccctgggtacatcgtgaggaacttccactaccttctcatcaaggatggctgcagggtgcctgctgtagtgttcaccacactgaggggccgccagctctgtgcacccccagaccagccctgggtagaacgcatcatccagagactgcagaggacctcagccaagatgaagcgccgcagcagttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCL19
-
Short nameCCL19 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) ligand 19 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) ligand 19, CKb11 and ELC and MIP-3b and MIP3B and SCYA19, CCL19 and IDBG-61011 and ENSG00000172724 and 6363, CCR chemokine receptor binding, Extracellular, CCL19 and IDBG-635974 and ENSBTAG00000012684 and 509167
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine ligand 19
-
Synonyms gene
-
Synonyms gene name
- small inducible cytokine subfamily A (Cys-Cys), member 19
- chemokine (C-C motif) ligand 19
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-02-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Chemokine ligands
-
VEGA ID