KLRC4 cloning plasmid
-
Catalog numberCSB-CL012469HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the KLRC4 gene.
-
SpecificationsGene name: KLRC4; Gene ID: 8302; Accession number: BC017784; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 477; Sequence: atgaataaacaaagaggaacctactcagaagtgagtctggcccaggacccaaagaggcagcaaaggaaacttaagggcaataaaatctccatttcaggaaccaaacaggaaatattccaagtagaattaaaccttcaaaatgcttcttcggatcatcaagggaatgacaagacatatcactgcaaaggtttactgccacctccagagaagctcactgctgaggtcctaggaatcatttgcattgtcctgatggccactgtgttaaaaacaatagttcttattccttgtattggagtactggagcagaacaatttttccctgaatagaagaatgcagaaagcacgtcattgtggccattgtcctgaggagtggattacatattccaacagttgttattacattggtaaggaaagaagaacttgggaagaaagagtttgctggcctgtgcttcgaagaactctgatctgctttctatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolKLRC4-KLRK1, KLRC4
-
Short nameKLRC4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namekiller cellular lectin-like receptor subfamily C, member 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetkiller cell lectin-like receptor subfamily C, member 4, NKG2-F and NKG2F, KLRC4 and IDBG-18873 and ENSG00000183542 and 8302, Plasma membranes
-
Gene info
-
Identity
-
Gene
-
Long gene nameKLRC4-KLRK1 readthrough
-
Locus
-
Discovery year2013-09-25
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namekiller cell lectin like receptor C4
-
Synonyms gene name
- killer cell lectin-like receptor subfamily C, member 4
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-09-03
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Killer cell lectin like receptors
-
VEGA ID