ALG13 cloning plasmid
-
Catalog numberCSB-CL885677HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ALG13 gene.
-
SpecificationsGene name: ALG13; Gene ID: 79868; Accession number: BC005336; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 498; Sequence: atgaagtgcgtgtttgttaccgtagggaccaccagctttgacgacctcattgcgtgtgtgtcggcgcccgacagtctgcaaaaaatcgagagccttggttacaaccgacttatcctgcaaattggtagaggaacggtggtacctgaacccttcagtactgagtcgtttactctggatgtttacaggtacaaggattccttgaaagaagacattcagaaagcagatcttgttattagtcacgcaggtgcaggaagctgtttggagactctggaaaaaggaaagccactcgtagtggttataaacgaaaagttgatgaacaatcatcagctggaactggcaaagcagctacacaaagagggtcatctcttctattgtacctgcagcacgcttcctgggctgttacagtcaatggacttatcaacactgaaatgttatcctcctggccagccagaaaaattttctgcatttttggataaagttgttggattacaaaaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolALG13-AS1, ALG13
-
Short nameALG13 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameALG13 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameALG13 antisense RNA 1
-
Synonyms gene name
- ALG13 antisense RNA 1 (non-protein coding)
-
Locus
-
Discovery year2011-07-29
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameALG13 UDP-N-acetylglucosaminyltransferase subunit
-
Synonyms gene
-
Synonyms gene name
- glycosyltransferase 28 domain containing 1
- chromosome X open reading frame 45
- asparagine-linked glycosylation 13 homolog (S. cerevisiae)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-09-16
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- UDP-N-acetylglucosaminyltransferase subunits
- OTU domain containing
- Tudor domain containing
-
VEGA ID
-
Locus Specific Databases