TLX3 cloning plasmid

• Catalog number
  CSB-CL023611HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TLX3 gene.
• Specifications
  Gene name: TLX3; Gene ID: 30012; Accession number: BC017291; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 876; Sequence: atggaggcgcccgccagcgcgcagaccccgcacccgcacgagcccatcagcttcggcatcgaccagatccttaacagcccggaccaggacagcgcacccgccccgcggggccccgacggcgccagctacctgggagggccccccgggggccgtccgggcgccacatacccgtctctgcccgcctcctttgcgggcctcggcgcgcccttcgaggacgcgggatcttacagtgtgaacctgagcctagcgcccgcaggcgtgatccgggtgccggcgcacaggccgctgcccggggccgtgccaccgcctctgccaagcgcgctacccgccatgccctccgtgcccacggtctccagccttggcggtctcaatttcccctggatggagagcagccgccgcttcgtgaaagaccgcttcacagcggcggccgcactcacgcccttcaccgtgacccggcgcatcggccacccctaccagaaccggacgccgcccaagcgtaagaagccgcgcacgtccttttcccgggtgcagatctgcgagctggaaaagcgcttccatcgccagaagtacctggcctctgccgagagggcggcgctcgccaagtccctcaaaatgacggacgcgcaggtcaagacctggttccaaaaccggaggaccaagtggcggcggcagacggcggaggagcgggaggcggagcggcagcaggcgagccggctcatgctgcagctgcaacacgacgccttccaaaagagcctcaacgactccatccagcctgacccgctctgtctgcacaactcgtcactctttgctctgcagaatctgcagccctgggaggaggatagttccaaggttcccgctgtcacctccctggtgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TLX3   cloning  
• Gene symbol
  TLX3
• Short name
  TLX3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  T-cellular leukemia homeobox 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  T-cell leukemia homeobox 3, TLX3 and IDBG-57439 and ENSG00000164438 and 30012, sequence-specific DNA binding, nuclei, Tlx3 and IDBG-161051 and ENSMUSG00000040610 and 27140, TLX3 and IDBG-628419 and ENSBTAG00000010003 and 618473,789584

Gene info

• Identity
  HGNC:13532
• Gene
  TLX3
• Long gene name
  T cell leukemia homeobox 3
• Synonyms gene
  • HOX11L2
• Synonyms gene name
  • homeo box 11-like 2
  • T-cell leukemia, homeobox 3
  • T-cell leukemia homeobox 3
• Synonyms
  • RNX
• GenBank acession
  • AJ223798
• Locus
  5q35.1
• Discovery year
  2001-12-17
• Entrez gene record
  30012
• Pubmed identfication
  • 11435718
  • 11435716
• Classification
  • NKL subclass homeoboxes and pseudogenes
• VEGA ID
  OTTHUMG00000163207

Similar products