TLX3 cloning plasmid
-
Catalog numberCSB-CL023611HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TLX3 gene.
-
SpecificationsGene name: TLX3; Gene ID: 30012; Accession number: BC017291; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 876; Sequence: atggaggcgcccgccagcgcgcagaccccgcacccgcacgagcccatcagcttcggcatcgaccagatccttaacagcccggaccaggacagcgcacccgccccgcggggccccgacggcgccagctacctgggagggccccccgggggccgtccgggcgccacatacccgtctctgcccgcctcctttgcgggcctcggcgcgcccttcgaggacgcgggatcttacagtgtgaacctgagcctagcgcccgcaggcgtgatccgggtgccggcgcacaggccgctgcccggggccgtgccaccgcctctgccaagcgcgctacccgccatgccctccgtgcccacggtctccagccttggcggtctcaatttcccctggatggagagcagccgccgcttcgtgaaagaccgcttcacagcggcggccgcactcacgcccttcaccgtgacccggcgcatcggccacccctaccagaaccggacgccgcccaagcgtaagaagccgcgcacgtccttttcccgggtgcagatctgcgagctggaaaagcgcttccatcgccagaagtacctggcctctgccgagagggcggcgctcgccaagtccctcaaaatgacggacgcgcaggtcaagacctggttccaaaaccggaggaccaagtggcggcggcagacggcggaggagcgggaggcggagcggcagcaggcgagccggctcatgctgcagctgcaacacgacgccttccaaaagagcctcaacgactccatccagcctgacccgctctgtctgcacaactcgtcactctttgctctgcagaatctgcagccctgggaggaggatagttccaaggttcccgctgtcacctccctggtgtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTLX3
-
Short nameTLX3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameT-cellular leukemia homeobox 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetT-cell leukemia homeobox 3, TLX3 and IDBG-57439 and ENSG00000164438 and 30012, sequence-specific DNA binding, nuclei, Tlx3 and IDBG-161051 and ENSMUSG00000040610 and 27140, TLX3 and IDBG-628419 and ENSBTAG00000010003 and 618473,789584
-
Gene info
-
Identity
-
Gene
-
Long gene nameT cell leukemia homeobox 3
-
Synonyms gene
-
Synonyms gene name
- homeo box 11-like 2
- T-cell leukemia, homeobox 3
- T-cell leukemia homeobox 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-12-17
-
Entrez gene record
-
Pubmed identfication
-
Classification
- NKL subclass homeoboxes and pseudogenes
-
VEGA ID