DMRTC1 cloning plasmid
-
Catalog numberCSB-CL702406HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the DMRTC1 gene.
-
SpecificationsGene name: DMRTC1; Gene ID: 63947; Accession number: BC029799; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 333; Sequence: atggctgcccctcccaaagctcccatccgtgtcaggaatttgaccatcagagcaggagccctcactgggaaggagaacaacatgctgcagcccgagacccacatcttcacagcccccgaggaggggagctcccaaggggctctgctgcttggccaggccccagaacctttgtctctgccctgtactccagtgaccttggagcagcaactggtttctccttctggggatccccacagggcccctgccctgcccagcatatgctcaactctgatcctccagccctgtgccacccttgaccctcttctactgcagccacaggtcctgggaaagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolDMRTC1, FAM236A
-
Short nameDMRTC1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameDMRTC1 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameDMRT like family C1
-
Synonyms gene name
- DMRT-like family C1
-
GenBank acession
-
Locus
-
Discovery year2000-11-24
-
Entrez gene record
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namefamily with sequence similarity 235 member A
-
Synonyms gene
-
Synonyms gene name
- DMRTC1 antisense RNA 1 (non-protein coding)
- DMRTC1 antisense RNA 1
- long intergenic non-protein coding RNA 684
-
Locus
-
Discovery year2012-08-02
-
Entrez gene record
-
RefSeq identity
-
VEGA ID