PIN1 cloning plasmid
-
Catalog numberCSB-CL615698HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PIN1 gene.
-
SpecificationsGene name: PIN1; Gene ID: 5300; Accession number: BC002899; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 492; Sequence: atggcggacgaggagaagctgccgcccggctgggagaagcgcatgagccgcagctcaggccgagtgtactacttcaaccacatcactaacgccagccagtgggagcggcccagcggcaacagcagcagtggtggcaaaaacgggcagggggagcctgccagggtccgctgctcgcacctgctggtgaagcacagccagtcacggcggccctcgtcctggcggcaggagaagatcacccggaccaaggaggaggccctggagctgatcaacggctacatccagaagatcaagtcgggagaggaggactttgagtctctggcctcacagttcagcgactgcagctcagccaaggccaggggagacctgggtgccttcagcagaggtcagatgcagaagccatttgaagacgcctcgtttgcgctgcggacgggggagatgagcgggcccgtgttcacggattccggcatccacatcatcctccgcactgagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPIN1-DT, PIN1
-
Short namePIN1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepeptidylprolyl cis/trans isomerase, NIMA-interacting 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpeptidylprolyl cis/trans isomerase, NIMA-interacting 1, DOD and UBL5, PIN1 and IDBG-26087 and ENSG00000127445 and 5300, phosphothreonine binding, nuclei, PIN1 and IDBG-643081 and ENSBTAG00000016988 and 535470
-
Gene info
-
Identity
-
Gene
-
Long gene namePIN1 divergent transcript
-
Locus
-
Discovery year2020-10-15
-
Entrez gene record
-
Classification
- Divergent transcripts
Gene info
-
Identity
-
Gene
-
Long gene namepeptidylprolyl cis/trans isomerase, NIMA-interacting 1
-
Synonyms gene name
- protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1996-12-16
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Parvulins
-
VEGA ID
-
Locus Specific Databases