GCLM cloning plasmid
-
Catalog numberCSB-CL009322HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GCLM gene.
-
SpecificationsGene name: GCLM; Gene ID: 2730; Accession number: BC041809; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 825; Sequence: atgggcaccgacagccgcgcggccaaggcgctcctggcgcgggcccgcaccctgcacctgcagacggggaacctgctgaactggggccgcctgcggaagaagtgcccgtccacgcacagcgaggagcttcatgattgtatccaaaaaaccttgaatgaatggagttcccaaatcaacccagatttggtcagggagtttccagatgtcttggaatgcactgtatctcatgcagtagaaaagataaatcctgatgaaagagaagaaatgaaagtttctgcaaaactgttcattgtagaatcaaactcttcatcatcaactagaagtgcagttgacatggcctgttcagtccttggagttgcacagctggattctgtgatcattgcttcacctcctattgaagatggagttaatctttccttggagcatttacagccttactgggaggaattagaaaacttagttcagagcaaaaagattgttgccataggtacctctgatctagacaaaacacagttggaacagctgtatcagtgggcacaggtaaaaccaaatagtaaccaagttaatcttgcctcctgctgtgtgatgccaccagatttgactgcatttgctaaacaatttgacatacagctgttgactcacaatgatccaaaagaactgctttctgaagcaagtttccaagaagctcttcaggaaagcattcctgacattcaagcgcacgagtgggtgccgctgtggctactgcggtattcggtcattgtgaaaagtagaggaattatcaaatcaaaaggctacattttacaagctaaaagaaggggttcttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGCLM
-
Short nameGCLM cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameglutamate-cysteine ligase, modifier subunit cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetglutamate-cysteine ligase, modifier subunit, GLCLR, GCLM and IDBG-100355 and ENSG00000023909 and 2730, protein heterodimerization activity, Cytoplasm, Gclm and IDBG-191550 and ENSMUSG00000028124 and 14630, GCLM and IDBG-636430 and ENSBTAG00000007842 and 525659
-
Gene info
-
Identity
-
Gene
-
Long gene nameglutamate-cysteine ligase modifier subunit
-
Synonyms gene
-
Synonyms gene name
- glutamate-cysteine ligase, modifier subunit
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-01-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID