PLDN cloning plasmid
-
Catalog numberCSB-CL890745HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PLDN gene.
-
SpecificationsGene name: PLDN; Gene ID: 26258; Accession number: BC004819; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 519; Sequence: atgagtgtccctgggccgtcgtctccggacggggccctgacacggccaccctactgcctggaggccggggagccgacgcctggtttaagtgacacttctccagatgaagggttaatagaggacttgactatagaagacaaagcagtggagcaactggcagaaggattgctttctcattatttgccagatctgcagagatcaaaacaagccctccaggaactcacacagaaccaagttgtattgttagacacactggaacaagagatttcaaaatttaaagaatgtcattctatgttggatattaatgctttgtttgctgaggctaaacactatcatgccaagttggtgaatataagaaaagagatgctgatgcttcatgaaaaaacatcaaagttaaaaaaaagagcacttaaactgcagcagaagaggcaaaaagaagagttggaaagggagcagcaacgagagaaggagtttgaaagagaaaagcagttaactgccagaccagccaaaaggatgtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBLOC1S6
-
Short namePLDN cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namebiogenesis on lysosomal organelles complex-1, subunit 6, pallidin cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetbiogenesis of lysosomal organelles complex-1, subunit 6, pallidin, PLDN and IDBG-10516 and ENSG00000104164 and 26258, actin filament binding, Plasma membranes, Bloc1s6 and IDBG-203214 and ENSMUSG00000005804 and 18457, PLDN and IDBG-646689 and ENSBTAG00000012250 and 614408
-
Gene info
-
Identity
-
Gene
-
Long gene namebiogenesis of lysosomal organelles complex 1 subunit 6
-
Synonyms gene
-
Synonyms gene name
- pallid (mouse) homolog, pallidin
- pallidin homolog (mouse)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-01-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Biogenesis of lysosomal organelles complex 1 subunits
-
VEGA ID
-
Locus Specific Databases