FASLG cloning plasmid

• Catalog number
  CSB-CL008434HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FASLG gene.
• Specifications
  Gene name: FASLG; Gene ID: 356; Accession number: BC017502; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 846; Sequence: atgcagcagcccttcaattacccatatccccagatctactgggtggacagcagtgccagctctccctgggcccctccaggcacagttcttccctgtccaacctctgtgcccagaaggcctggtcaaaggaggccaccaccaccaccgccaccgccaccactaccacctccgccgccgccgccaccactgcctccactaccgctgccacccctgaagaagagagggaaccacagcacaggcctgtgtctccttgtgatgtttttcatggttctggttgccttggtaggattgggcctggggatgtttcagctcttccacctacagaaggagctggcagaactccgagagtctaccagccagatgcacacagcatcatctttggagaagcaaataggccaccccagtccaccccctgaaaaaaaggagctgaggaaagtggcccatttaacaggcaagtccaactcaaggtccatgcctctggaatgggaagacacctatggaattgtcctgctttctggagtgaagtataagaagggtggccttgtgatcaatgaaactgggctgtactttgtatattccaaagtatacttccggggtcaatcttgcaacaacctgcccctgagccacaaggtctacatgaggaactctaagtatccccaggatctggtgatgatggaggggaagatgatgagctactgcactactgggcagatgtgggcccgcagcagctacctgggggcagtgttcaatcttaccagtgctgatcatttatatgtcaacgtatctgagctctctctggtcaattttgaggaatctcagacgtttttcggcttatataagctctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FASLG   cloning  
• Gene symbol
  FASLG
• Short name
  FASLG cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  Fas (tumor necrosis factor receptor superfamily, member 6) ligand (tumor necrosis factor superfamily, member 6) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  Fas ligand (TNF superfamily, member 6), ALPS1B and APT1LG1 and APTL and CD178 and CD95-L and CD95L and FASL and TNFSF6, FASLG and IDBG-104856 and ENSG00000117560 and 356, protein binding, nuclei, Fasl and IDBG-201576 and ENSMUSG00000000817 and 14103, LOC407111 and IDBG-632305 and ENSBTAG00000032808 and 101908770,407111

Gene info

• Identity
  HGNC:11936
• Gene
  FASLG
• Long gene name
  Fas ligand
• Synonyms gene
  • APT1LG1
  • TNFSF6
• Synonyms gene name
  • tumor necrosis factor (ligand) superfamily, member 6
  • Fas ligand (TNF superfamily, member 6)
• Synonyms
  • FasL
  • CD178
• GenBank acession
  • U11821
• Locus
  1q24.3
• Discovery year
  1994-12-09
• Entrez gene record
  356
• Pubmed identfication
  • 7826947
  • 9022072
• Classification
  • Tumor necrosis factor superfamily
  • Death inducing signaling complex
  • CD molecules
• VEGA ID
  OTTHUMG00000034841
• Locus Specific Databases
  • FASLGbase: Mutation registry for Autoimmune lymphoproliferative syndrome, type 1B (ALPS1B) (previously known as TNFSF6base)
  • LRG_58

Similar products