PPP2R3B cloning plasmid
-
Catalog numberCSB-CL896533HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PPP2R3B gene.
-
SpecificationsGene name: PPP2R3B; Gene ID: 28227; Accession number: BC009032; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 531; Sequence: atggacctggacggggacggcgccctgtccatgttcgagctcgagtacttctacgaggagcagtgccgaaggctggacagcatggccatcgaggccctgcccttccaggactgcctctgccagatgctggacctggtcaagccgaggactgaagggaagatcacgctgcaggacctgaagcgctgcaagctggccaacgtcttcttcgacaccttcttcaacatcgagaagtacctcgaccacgagcagaaagagcagatctccctgctcagggacggtgacagcggcggccccgagctctcggactgggagaagtacgcggccgaggagtacgacatcctggtggccgaggagaccgcgggagagccctgggaggacgggttcgaggccgagctcagccccgtggagcagaagctgagtgcgctgcgctccccgctggcccagaggcccttcttcgaggcgccctcaccgctgggcgccgtggacctgtacgagtacgcgtgcggggacgaggacctggagccgctgtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPPP2R3B, LINC00685
-
Short namePPP2R3B cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namePPP2R3B cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameprotein phosphatase 2 regulatory subunit B''beta
-
Synonyms gene
-
Synonyms gene name
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2002-04-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- EF-hand domain containing
- Protein phosphatase 2 regulatory subunits
- Pseudoautosomal region 1
-
VEGA ID
-
Locus Specific Databases
Gene info
-
Identity
-
Gene
-
Long gene namelong intergenic non-protein coding RNA 685
-
Synonyms gene
-
Synonyms gene name
- chromosome X and Y open reading frame 10
- non-protein coding RNA 107
- PPP2R3B antisense RNA 1 (non-protein coding)
- PPP2R3B antisense RNA 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2008-10-09
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Pseudoautosomal region 1
- Long intergenic non-protein coding RNAs
-
VEGA ID