SPN cloning plasmid

  • Catalog number
    CSB-CL022590HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SPN gene.
  • Specifications
    Gene name: SPN; Gene ID: 6693; Accession number: BC012350; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1203; Sequence: atggccacgcttctccttctccttggggtgctggtggtaagcccagacgctctggggagcacaacagcagtgcagacacccacctccggagagcctttggtctctactagcgagcccctgagctcaaagatgtacaccacttcaataacaagtgaccctaaggccgacagcactggggaccagacctcagccctacctccctcaacttccatcaatgagggatcccctctttggacttccattggtgccagcactggttcccctttacctgagccaacaacctaccaggaagtttccatcaagatgtcatcagtgccccaggaaacccctcatgcaaccagtcatcctgctgttcccataacagcaaactctctaggatcccacaccgtgacaggtggaaccataacaacgaactctccagaaacctccagtaggaccagtggagcccctgttaccacggcagctagctctctggagacctccagaggcacctctggaccccctcttaccatggcaactgtctctctggagacttccaaaggcacctctggaccccctgttaccatggcaactgactctctggagacctccactgggaccactggaccccctgttaccatgacaactggctctctggagccctccagcggggccagtggaccccaggtctctagcgtaaaactatctacaatgatgtctccaacgacctccaccaacgcaagcactgtgcccttccggaacccagatgagaactcacgaggcatgctgccagtggctgtgcttgtggccctgctggcggtcatagtcctcgtggctctgctcctgctgtggcgccggcggcagaagcggcggactggggccctcgtgctgagcagaggcggcaagcgtaacggggtggtggacgcctgggctgggccagcccaggtccctgaggagggggccgtgacagtgaccgtgggagggtccgggggcgacaagggctctgggttccccgatggggaggggtctagccgtcggcccacgctcaccactttctttggcagacggaagtctcgccagggctccctggcgatggaggagctgaagtctgggtcaggccccagcctcaaaggggaggaggagccactggtggccagtgaggatggggctgtggacgccccagctcctgatgagcccgaagggggagacggggctgccccttaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SPN   cloning  
  • Gene symbol
    SPN, DEAF1, PPP1R9B
  • Short name
    SPN cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    sialophorin cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    sialophorin, CD43 and GALGP and GPL115 and LSN, SPN and IDBG-24512 and ENSG00000197471 and 101929889,6693, protein binding, Extracellular, Spn and IDBG-210057 and ENSMUSG00000051457 and 20737, SPN and IDBG-639328 and ENSBTAG00000026326 and 614645
Gene info
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    protein phosphatase 1 regulatory subunit 9B
  • Synonyms gene
  • Synonyms gene name
    • protein phosphatase 1, regulatory subunit 9B, spinophilin
    • protein phosphatase 1, regulatory (inhibitor) subunit 9B
    • protein phosphatase 1, regulatory subunit 9B
  • Synonyms
  • Synonyms name
  • GenBank acession
  • Locus
  • Discovery year
    1997-10-10
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • PDZ domain containing
    • Protein phosphatase 1 regulatory subunits
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee