SLC1A6 cloning plasmid
-
Catalog numberCSB-CL021437HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SLC1A6 gene.
-
SpecificationsGene name: SLC1A6; Gene ID: 6511; Accession number: BC028721; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 939; Sequence: atgagcagccatggcaacagcctgttcctgcgggagagcggccagcggctgggccgggtgggctggctgcagcggctgcaggaaagcctgcagcagagagcactgcgcacgcgcctgcgcctgcagaccatgaccctcgagcacgtgctgcgcttcctgcgccgaaacgccttcattctgctgacggtcagcgccgtggtcattggggtcagcctggcctttgccctgcgcccatatcagctcacctaccgccagatcaagtacttctcttttcctggagagcttctgatgaggatgctgcagatgctggtgttacctctcattgtctccagcctggtcacaggtatggcatccctggacaacaaggccacggggcggatggggatgcgggcagctgtgtactacatggtgaccaccatcatcgcggtcttcatcggcatcctcatggtcaccatcatccatcccgggaagggctccaaggaggggctgcaccgggagggccggatcgagaccatccccacagctgatgccttcatggacctgatcagaaatatgtttccaccaaaccttgtggaggcctgcttcaaacagttcaagacgcagtacagcacgagggtggtaaccaggaccatggtgaggacagagaacgggtctgagccgggtgcctccatgcctcctccattctcagtggagaacggaaccagcttcctggaaaatgtcactcgggccttgggtaccctgcaggagatgctgagctttgaggagactgtacccgtgcctggctccgccaatggcatcaacgccctgggcctcgtggtcttctctgtggcctttgggctggtcattggtggcatgaaacacaagggcagagtcctcagggacttcttcgacagcctcaatgaggctattatgaggctggtgggcatcattatctggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSLC1A6
-
Short nameSLC1A6 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetsolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6, EAAT4, SLC1A6 and IDBG-34070 and ENSG00000105143 and 6511, dicarboxylate symporter activity, Plasma membranes, Slc1a6 and IDBG-169554 and ENSMUSG00000005357 and 20513, SLC1A6 and IDBG-642590 and ENSBTAG00000013502 and
-
Gene info
-
Identity
-
Gene
-
Long gene namesolute carrier family 1 member 6
-
Synonyms gene name
- solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
-
Synonyms
-
Locus
-
Discovery year1997-02-05
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Solute carriers
-
VEGA ID