AGT cloning plasmid

  • Catalog number
    CSB-CL001463HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the AGT gene.
  • Specifications
    Gene name: AGT; Gene ID: 183; Accession number: BC011519; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1458; Sequence: atgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatgccgggaagcccaaagaccccaccttcatacctgctccaattcaggccaagacatcccctgtggatgaaaaggccctacaggaccagctggtgctagtcgctgcaaaacttgacaccgaagacaagttgagggccgcaatggtcgggatgctggccaacttcttgggcttccgtatatatggcatgcacagtgagctatggggcgtggtccatggggccaccgtcctctccccaacggctgtctttggcaccctggcctctctctatctgggagccttggaccacacagctgacaggctacaggcaatcctgggtgttccttggaaggacaagaactgcacctcccggctggatgcgcacaaggtcctgtctgccctgcaggctgtacagggcctgctagtggcccagggcagggctgatagccaggcccagctgctgctgtccacggtggtgggcgtgttcacagccccaggcctgcacctgaagcagccgtttgtgcagggcctggctctctatacccctgtggtcctcccacgctctctggacttcacagaactggatgttgctgctgagaagattgacaggttcatgcaggctgtgacaggatggaagactggctgctccctgacgggagccagtgtggacagcaccctggctttcaacacctacgtccacttccaagggaagatgaagggcttctccctgctggccgagccccaggagttctgggtggacaacagcacctcagtgtctgttcccatgctctctggcatgggcaccttccagcactggagtgacatccaggacaacttctcggtgactcaagtgtccttcactgagagcgcctgcctgctgctgatccagcctcactatgcctctgacctggacaaggtggagggtctcactttccagcaaaactccctcaactggatgaagaaactgtctccccggaccatccacctgaccatgccccaactggtgctgcaaggatcttatgacctgcaggacctgctcgcccaggctgagctgcccgccattctgcacaccgagctgaacctgcaaaaattgagcaatgaccgcatcagggtgggggaggtgctgaacagcattttttttgagcttgaagcggatgagagagagcccacagagtctacccaacagcttaacaagcctgaggtcttggaggtgaccctgaaccgcccattcctgtttgctgtgtatgatcaaagcgccactgccctgcacttcctgggccgcgtggccaacccgctgagcacagcatga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    AGT   cloning  
  • Gene symbol
    AGT, SLC7A13, AGXT, TRT-AGT3-1, TRT-AGT2-1, TRT-AGT2-2, TRT-AGT1-3, TRT-AGT7-1, TRT-AGT1-1, TRT-AGT1-2
  • Short name
    AGT cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    angiotensinogen (serpin peptidase inhibitor, clade A, member 8) cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    angiotensinogen (serpin peptidase inhibitor, clade A, member 8), ANHU and SERPINA8, AGT and IDBG-107363 and ENSG00000135744 and 183, type 2 angiotensin receptor binding, Extracellular, Agt and IDBG-200169 and ENSMUSG00000031980 and 11606, AGT and IDBG-632058 and ENSBTAG00000012393 and 527114
Gene info
Gene info
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    trRNA-Thr (anticodon AGT) 3-1
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 21 (anticodon AGU)
    • transfer RNA-Thr (AGT) 3-1
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (anticodon AGT) 2-1
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 14 (anticodon AGU)
    • transfer RNA-Thr (AGT) 2-1
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (anticodon AGT) 2-2
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 15 (anticodon AGU)
    • transfer RNA-Thr (AGT) 2-2
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (anticodon AGT) 1-3
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 4 (anticodon AGU)
    • transfer RNA-Thr (AGT) 1-3
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (AGT) 7-1
  • Synonyms gene
  • Synonyms gene name
    • tRNA threonine (AGU) 3
    • transfer RNA threonine 3 (anticodon AGU)
    • transfer RNA-Thr (AGT) 7-1
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1993-05-24
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Low confidence cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (anticodon AGT) 1-1
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 8 (anticodon AGU)
    • transfer RNA-Thr (AGT) 1-1
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-Thr (anticodon AGT) 1-2
  • Synonyms gene
  • Synonyms gene name
    • transfer RNA threonine 9 (anticodon AGU)
    • transfer RNA-Thr (AGT) 1-2
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2008-08-29
  • Entrez gene record
  • Classification
    • Cytoplasmic transfer RNAs
Similar products
Filters
Contact
Chat with gentaur.com employee