PSME3 cloning plasmid

• Catalog number
  CSB-CL018918HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PSME3 gene.
• Specifications
  Gene name: PSME3; Gene ID: 10197; Accession number: BC001423; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 765; Sequence: atggcctcgttgctgaaggtggatcaggaagtgaagctcaaggttgattctttcagggagcggatcacaagtgaggcagaagacttggtggcaaattttttcccaaagaagttattagaacttgatagttttctgaaggaaccaatcttaaacatccatgacctaactcagatccactctgacatgaatctcccagtccctgaccccattcttctcaccaatagccatgatggactggatggtcccacttataagaagcgaaggttggatgagtgtgaagaagccttccaaggaaccaaggtgtttgtgatgcccaatgggatgctgaaaagcaaccagcagctggtggacattattgagaaagtgaaacctgagatccggctgttgattgagaaatgtaacacggtcaaaatgtgggtacagctcctgattcccaggatagaagatggaaacaactttggggtgtccattcaggaggaaacagttgcagagctaagaactgttgagagtgaagctgcatcttatctggaccagatttctagatattatattacaagagccaaattggtttctaaaatagctaaatatccccatgtggaggactatcgccgcaccgtgacagagattgatgagaaagaatatatcagccttcggctcatcatatcagagctgaggaatcaatatgtcactctacatgacatgatcctgaaaaatatcgagaagatcaaacggccccggagcagcaatgcagagactctgtactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PSME3   cloning  
• Gene symbol
  PSME3
• Short name
  PSME3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki), HEL-S-283 and Ki and PA28-gamma and PA28G and PA28gamma and REG-GAMMA, PSME3 and IDBG-51809 and ENSG00000131467 and 10197, MDM2/MDM4 family protein binding, nuclei, Psme3 and IDBG-267041 and ENSMUSG00000078652 and 19192, PSME3 and IDBG-640458 and ENSBTAG00000019918 and 100336105

Gene info

• Identity
  HGNC:9570
• Gene
  PSME3
• Long gene name
  proteasome activator subunit 3
• Synonyms gene name
  • proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
• Synonyms
  • Ki
  • PA28-gamma
  • REG-GAMMA
  • PA28G
• GenBank acession
  • U11292
• Locus
  17q21.31
• Discovery year
  1999-06-04
• Entrez gene record
  10197
• Pubmed identfication
  • 7951316
• RefSeq identity
  • NM_176863
• Classification
  • Proteasome
• VEGA ID
  OTTHUMG00000180654

Similar products