APOC3 cloning plasmid
-
Catalog numberCSB-CL001933HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the APOC3 gene.
-
SpecificationsGene name: APOC3; Gene ID: 345; Accession number: BC027977; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 300; Sequence: atgcagccccgggtactccttgttgttgccctcctggcgctcctggcctctgcccgagcttcagaggccgaggatgcctcccttctcagcttcatgcagggttacatgaagcacgccaccaagaccgccaaggatgcactgagcagcgtgcaggagtcccaggtggcccagcaggccaggggctgggtgaccgatggcttcagttccctgaaagactactggagcaccgttaaggacaagttctctgagttctgggatttggaccctgaggtcagaccaacttcagccgtggctgcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAPOC3
-
Short nameAPOC3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameapolipoprotein C-III cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetapolipoprotein C-III, APOCIII and HALP2, APOC3 and IDBG-72562 and ENSG00000110245 and 345, high-density lipoprotein particle receptor binding, Extracellular, Apoc3 and IDBG-161220 and ENSMUSG00000032081 and 11814, APOC3 and IDBG-630792 and ENSBTAG00000012398 and 408009
-
Gene info
-
Identity
-
Gene
-
Long gene nameapolipoprotein C3
-
Synonyms gene name
- apolipoprotein C-III
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
RefSeq identity
-
Classification
- Apolipoproteins
-
VEGA ID