TIMM8A cloning plasmid
-
Catalog numberCSB-CL023557HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TIMM8A gene.
-
SpecificationsGene name: TIMM8A; Gene ID: 1678; Accession number: BC006994; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 294; Sequence: atggattcctcctcctcttcctccgcggcgggtttgggtgcagtggacccgcagttgcagcatttcatcgaggtagagactcaaaagcagcgcttccagcagctggtgcaccagatgactgaactttgttgggagaagtgcatggacaagcctgggccaaagttggacagtcgggctgaggcctgttttgtgaactgcgttgagcgcttcattgatacaagccagttcatcttgaatcgactggaacagacccagaaatccaagccagttttctcagaaagcctttctgactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTIMM8A
-
Short nameTIMM8A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametranslocase on inner mitochondrial membrane 8 homolog A (yeast) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettranslocase of inner mitochondrial membrane 8 homolog A (yeast), DDP and DDP1 and DFN1 and MTS and TIM8, TIMM8A and IDBG-79593 and ENSG00000126953 and 1678, metal ion binding, Cytoplasm, TIMM8A and IDBG-633444 and ENSBTAG00000022292 and 515109
-
Gene info
-
Identity
-
Gene
-
Long gene nametranslocase of inner mitochondrial membrane 8A
-
Synonyms gene
-
Synonyms gene name
- translocase of inner mitochondrial membrane 8 (yeast) homolog A
- translocase of inner mitochondrial membrane 8 homolog A (yeast)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-12-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID