NDUFS1 cloning plasmid

• Catalog number
  CSB-CL015660HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NDUFS1 gene.
• Specifications
  Gene name: NDUFS1; Gene ID: 4719; Accession number: BC012068; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 768; Sequence: atggtggttttaggcagttctgcactccaaagaaatgatggagcagcaattcttgcagctgtttctagcattgcacaaaagattcggatgactagtggtgttactggtgattggaaagttatgaatatccttcataggattgcaagtcaagtagctgctttggaccttggctataagcctggggtggaagcaattcggaagaaccctcccaaggtgctgtttctcctgggagcagatggaggttgtatcacacgacaggatttgccaaaggattgtttcattatttatcaaggacatcatggtgatgttggggctcccatagctgatgttattctcccaggagctgcttacacagagaagtctgctacatatgtcaacactgagggtagagctcagcagactaaggtagcagtgacacctcctggcttggcaagagaagactggaaaattataagagcactctctgagattgctggaatgactcttccatatgatactctggatcaagtaaggaacagattggaagaagtctctcctaatcttgttcgatatgatgatattgaaggggctaattacttccagcaagcaaatgagctctcaaagctagtgaaccagcagcttcttgctgacccacttgttccacctcagctaactataaaagacttctacatgacagattcaattagcagagcctcacagacaatggccaaatgtgtcaaagctgtcacagagggtgcccaggcagtagaggaaccatccatatgctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NDUFS1   cloning  
• Gene symbol
  NDUFS1
• Short name
  NDUFS1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase), CI-75k and CI-75Kd and PRO1304, NDUFS1 and IDBG-79438 and ENSG00000023228 and 4719, oxidoreductase activity, Plasma membranes, Ndufs1 and IDBG-160282 and ENSMUSG00000025968 and 227197, NDUFS1 and IDBG-643401 and ENSBTAG00000021976 and 288380

Gene info

• Identity
  HGNC:7707
• Gene
  NDUFS1
• Long gene name
  NADH:ubiquinone oxidoreductase core subunit S1
• Synonyms gene name
  • NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)
  • NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
• Synonyms
  • CI-75k
• Synonyms name
  • complex I 75kDa subunit
  • NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial
• Locus
  2q33.3
• Discovery year
  1992-04-03
• Entrez gene record
  4719
• Pubmed identfication
  • 1935949
• RefSeq identity
  • NM_005006
• Classification
  • NADH:ubiquinone oxidoreductase core subunits
• VEGA ID
  OTTHUMG00000132892

Similar products