PSMG3 cloning plasmid
-
Catalog numberCSB-CL861132HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMG3 gene.
-
SpecificationsGene name: PSMG3; Gene ID: 84262; Accession number: BC004308; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 369; Sequence: atggaagacacgccgttggtgatatcgaagcagaagacggaggtggtgtgcggggtccccacccaggtggtgtgtacggccttcagcagtcacatcctggtggtggtgacccagtttgggaagatgggcaccctggtctccctggagcccagcagcgtggccagtgacgtcagcaagcctgtgctcaccacaaaagtccttctggggcaggatgagcctctcatccatgtctttgcaaagaacctggtagcgtttgtgtctcaagaagctggaaacagagcagtcctcctcgccgtggccgtgaaggacaaaagcatggaggggctgaaggcgctgagggaggtgatccgggtgtgccaggtgtggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMG3-AS1, PSMG3
-
Short namePSMG3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) assembly chaperone 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) assembly chaperone 3, PSMG3 and IDBG-6677 and ENSG00000157778 and 84262, multiple, Psmg3 and IDBG-206798 and ENSMUSG00000029551 and 66506, PSMG3 and IDBG-641358 and ENSBTAG00000000050 and 510741
-
Gene info
-
Identity
-
Gene
-
Long gene namePSMG3 antisense RNA 1 (head to head)
-
Synonyms
-
Locus
-
Discovery year2012-11-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome assembly chaperone 3
-
Synonyms gene
-
Synonyms gene name
- chromosome 7 open reading frame 48
- proteasome (prosome, macropain) assembly chaperone 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2006-08-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID