LSM14B cloning plasmid
-
Catalog numberCSB-CL880122HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LSM14B gene.
-
SpecificationsGene name: LSM14B; Gene ID: 149986; Accession number: BC054888; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 237; Sequence: atgagccccggcagcgccttggcccttctgtggtccctgccagcctctgacctgggccggtcagtcattgctggactctggccacacactggcgttctcatccacttggaaacaagccagtcttttctgcaaggtcagttgaccaagagcatatttcccctctgttgtacatcgttgttttgtgtttgtgttgtaacagtgggtggagggagggtggggtctacatttgttgcatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLSM14B
-
Short nameLSM14B cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameLSM14B, SCD6 homolog B (S. cerevisiae) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetLSM14B, SCD6 homolog B (S. cerevisiae), LSM14B and IDBG-83863 and ENSG00000149657 and 149986, poly(A) RNA binding, multiple, Lsm14b and IDBG-213717 and ENSMUSG00000039108 and 241846
-
Gene info
-
Identity
-
Gene
-
Long gene nameLSM family member 14B
-
Synonyms gene
-
Synonyms gene name
- chromosome 20 open reading frame 40
- family with sequence similarity 61, member B
- LSM14 homolog B (SCD6, S. cerevisiae)
- LSM14B, SCD6 homolog B (S. cerevisiae)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-06-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- LSm proteins
-
VEGA ID