MAX cloning plasmid
-
Catalog numberCSB-CL013527HU3-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MAX gene.
-
SpecificationsGene name: MAX; Gene ID: 4149; Accession number: BC036092; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 405; Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaacagaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccacagaatatatccagtatatgcgaaggaaaaaccacacacaccagcaagatattgacgacctcaagcggcagaatgctcttctggagcagcaaggtgagcacccgagctcgtggggcagctggccctgctgtgctccagccaggtcaggctttggcacctgggcctgcagagtcagagccagtcatggagtatgtgctcagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMAX
-
Short nameMAX cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namev-myc myelocytomatosis viral oncogene homolog (avian) associated factor X cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetMYC associated factor X, bHLHd4, MAX and IDBG-9524 and ENSG00000125952 and 4149, protein dimerization activity, nuclei, Max and IDBG-151490 and ENSMUSG00000059436 and 17187, MAX and IDBG-646780 and ENSBTAG00000017994 and 540616
-
Gene info
-
Identity
-
Gene
-
Long gene nameMYC associated factor X
-
Synonyms gene name
- MAX protein
-
Synonyms
-
Locus
-
Discovery year1992-10-27
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Basic helix-loop-helix proteins
-
VEGA ID
-
Locus Specific Databases