M6PR cloning plasmid
-
Catalog numberCSB-CL013293HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the M6PR gene.
-
SpecificationsGene name: M6PR; Gene ID: 4074; Accession number: BC024206; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 834; Sequence: atgttccctttctacagctgctggaggactggactgctactactactcctggctgtggcagtgagagaatcctggcagacagaagaaaaaacttgcgacttggtaggagaaaagggtaaagagtcagagaaagagttggctctagtgaagaggctgaaaccactgtttaataaaagctttgagagcactgtgggccagggttcagacacatacatctacatcttcagggtgtgccgggaagctggcaaccacacttctggggcaggcctggtgcaaatcaacaaaagtaatgggaaggagacagtggtagggagactcaacgagactcacatcttcaacggaagtaattggatcatgctgatctataaagggggtgatgaatatgacaaccactgtggcaaggagcagcgtcgtgcagtggtgatgatctcctgcaatcgacacaccctagcggacaattttaaccctgtgtctgaggagcgtggcaaagtccaagattgtttctacctctttgagatggatagcagcctggcctgttcaccagagatctcccacctcagtgtgggttccatcttacttgtcacgtttgcatcactggttgctgtttatgttgttggggggttcctataccagcgactggtagtgggagccaaaggaatggagcagtttccccacttagccttctggcaggatcttggcaacctggtagcagatggctgtgactttgtctgccgttctaaacctcgaaatgtgcctgcagcatatcgtggtgtgggggatgaccagctgggggaggagtcagaagaaagggatgaccatttattaccaatgtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolM6PR, IGF2R
-
Short nameM6PR cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemannose-6-phosphate receptor (cation dependent) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmannose-6-phosphate receptor (cation dependent), CD-MPR and MPR 46 and MPR-46 and MPR46 and SMPR, M6PR and IDBG-17511 and ENSG00000003056 and 4074, mannose transmembrane transporter activity, Plasma membranes, M6pr and IDBG-185276 and ENSMUSG00000007458 and 17113, M6PR and IDBG-639695 and ENSBTAG00000018207 and 281291
-
Gene info
-
Identity
-
Gene
-
Long gene namemannose-6-phosphate receptor, cation dependent
-
Synonyms gene name
- mannose-6-phosphate receptor (cation dependent)
-
Synonyms
-
Locus
-
Discovery year1989-06-30
-
Entrez gene record
-
Classification
- MRH domain containing
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameinsulin like growth factor 2 receptor
-
Synonyms gene name
- insulin-like growth factor 2 receptor
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1988-07-07
-
Entrez gene record
-
RefSeq identity
-
Classification
- MRH domain containing
- CD molecules
-
VEGA ID
-
Locus Specific Databases