M6PR cloning plasmid

  • Catalog number
    CSB-CL013293HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the M6PR gene.
  • Specifications
    Gene name: M6PR; Gene ID: 4074; Accession number: BC024206; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 834; Sequence: atgttccctttctacagctgctggaggactggactgctactactactcctggctgtggcagtgagagaatcctggcagacagaagaaaaaacttgcgacttggtaggagaaaagggtaaagagtcagagaaagagttggctctagtgaagaggctgaaaccactgtttaataaaagctttgagagcactgtgggccagggttcagacacatacatctacatcttcagggtgtgccgggaagctggcaaccacacttctggggcaggcctggtgcaaatcaacaaaagtaatgggaaggagacagtggtagggagactcaacgagactcacatcttcaacggaagtaattggatcatgctgatctataaagggggtgatgaatatgacaaccactgtggcaaggagcagcgtcgtgcagtggtgatgatctcctgcaatcgacacaccctagcggacaattttaaccctgtgtctgaggagcgtggcaaagtccaagattgtttctacctctttgagatggatagcagcctggcctgttcaccagagatctcccacctcagtgtgggttccatcttacttgtcacgtttgcatcactggttgctgtttatgttgttggggggttcctataccagcgactggtagtgggagccaaaggaatggagcagtttccccacttagccttctggcaggatcttggcaacctggtagcagatggctgtgactttgtctgccgttctaaacctcgaaatgtgcctgcagcatatcgtggtgtgggggatgaccagctgggggaggagtcagaagaaagggatgaccatttattaccaatgtag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    M6PR   cloning  
  • Gene symbol
    M6PR, IGF2R
  • Short name
    M6PR cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    mannose-6-phosphate receptor (cation dependent) cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    mannose-6-phosphate receptor (cation dependent), CD-MPR and MPR 46 and MPR-46 and MPR46 and SMPR, M6PR and IDBG-17511 and ENSG00000003056 and 4074, mannose transmembrane transporter activity, Plasma membranes, M6pr and IDBG-185276 and ENSMUSG00000007458 and 17113, M6PR and IDBG-639695 and ENSBTAG00000018207 and 281291
Gene info
  • Identity
  • Gene
  • Long gene name
    mannose-6-phosphate receptor, cation dependent
  • Synonyms gene name
    • mannose-6-phosphate receptor (cation dependent)
  • Synonyms
  • Locus
  • Discovery year
    1989-06-30
  • Entrez gene record
  • Classification
    • MRH domain containing
  • VEGA ID
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee