NEFL cloning plasmid
-
Catalog numberCSB-CL015688HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NEFL gene.
-
SpecificationsGene name: NEFL; Gene ID: 4747; Accession number: BC066952; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 855; Sequence: atgagttccttcagctacgagccgtactactcgacctcctacaagcggcgctacgtggagacgccccgggtgcacatctccagcgtgcgcagcggctacagcaccgcacgctcagcttactccagctactcggcgccggtgtcttcctcgctgtccgtgcgccgcagctactcctccagctctggatcgttgatgcccagtctggagaacctcgacctgagccaggtagccgccatcagcaacgacctcaagtccatccgcacgcaggagaaggcgcagctccaggacctcaatgaccgcttcgccagcttcatcgagcgcgtgcacgagctggagcagcagaacaaggtcctggaagccgagctgctggtgctgcgccagaagcactccgagccatcccgcttccgggcgctgtacgagcaggagatccgcgacctgcgcctggcggcggaagatgccaccaacgagaagcaggcgctccagggcgagcgcgaagggctggaggagaccctgcgcaacctgcaggcgcgctatgaagaggaggtgctgagccgcgaggacgccgagggccggctgatggaagcgcgcaaaggcgccaagaacaccgacgccgtgcgcgccgccaaggacgaggtgtccgagagccgtcgtctgctcaaggccaagaccctggaaatcgaagcatgccggggcatgaatgaagcgctggagaagcagctgcaggagctggaggacaagcagaacgccgacatcagcgttatgcaggacacgatcaacaaattagaaaatgaattgaggaccacaaagagtgaaatggcacgatacctaaaagaataccaagacctcctaacgtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNEFL
-
Short nameNEFL cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneurofilament, light polypeptide cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneurofilament, light polypeptide, CMT1F and CMT2E and NF-L and NF68 and NFL and PPP1R110, NEFL and IDBG-777808 and ENSG00000277586 and 4747, protein binding, Cytoplasm, Nefl and IDBG-176493 and ENSMUSG00000022055 and 18039, NEFL and IDBG-635366 and ENSBTAG00000021949 and 281348
-
Gene info
-
Identity
-
Gene
-
Long gene nameneurofilament light chain
-
Synonyms gene name
- neurofilament, light polypeptide 68kDa
- neurofilament, light polypeptide
- neurofilament light
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Intermediate filaments Type IV
- Protein phosphatase 1 regulatory subunits
- MicroRNA protein coding host genes
-
VEGA ID
-
Locus Specific Databases