IL18 cloning plasmid
-
Catalog numberCSB-CL614514HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IL18 gene.
-
SpecificationsGene name: IL18; Gene ID: 3606; Accession number: BC007007; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 582; Sequence: atggctgctgaaccagtagaagacaattgcatcaactttgtggcaatgaaatttattgacaatacgctttactttatagctgaagatgatgaaaacctggaatccgattactttggcaagcttgaatctaaattatcagtcataagaaatttgaatgaccaagttctcttcattgaccaaggaaatcggcctctatttgaagatatgactgattctgactgtagagataatgcaccccggaccatatttattataagtatgtataaagatagccagcctagaggtatggctgtaactatctctgtgaagtgtgagaaaatttcaactctctcctgtgagaacaaaattatttcctttaaggaaatgaatcctcctgataacatcaaggatacaaaaagtgacatcatattctttcagagaagtgtcccaggacatgataataagatgcaatttgaatcttcatcatacgaaggatactttctagcttgtgaaaaagagagagacctttttaaactcattttgaaaaaagaggatgaattgggggatagatctataatgttcactgttcaaaacgaagactag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIL18
-
Short nameIL18 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinterleukin 18 (interferon-gamma-inducing factor) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinterleukin 18 (interferon-gamma-inducing factor), IGIF and IL-18 and IL-1g and IL1F4, IL18 and IDBG-71390 and ENSG00000150782 and 3606, cytokine activity, Extracellular, Il18 and IDBG-163502 and ENSMUSG00000039217 and 16173, IL18 and IDBG-630481 and ENSBTAG00000000277 and 281249
-
Gene info
-
Identity
-
Gene
-
Long gene nameinterleukin 18
-
Synonyms gene name
- interleukin 18 (interferon-gamma-inducing factor)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-07-25
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Interleukins
-
VEGA ID