NF2 cloning plasmid
-
Catalog numberCSB-CL015741HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NF2 gene.
-
SpecificationsGene name: NF2; Gene ID: 4771; Accession number: BC007279; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 249; Sequence: atggtggtttcattacgagcccttctgctggctctcaggcagaagccccacagcaccgggaccattcatgaggtcactgcccagctcatgatgtccgtgaggctgtccttttggccagtagccgtgtgcagctgtgtggcacagatggcttcgttcatcctgatcaaggccccacctcagccacagcagtccccccaacctgtgttgtccaccctattattcatgtacctgccaggccctgctagatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNF2
-
Short nameNF2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneurofibromin 2 (merlin) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneurofibromin 2 (merlin), ACN and BANF and SCH, NF2 and IDBG-3678 and ENSG00000186575 and 4771, cytoskeletal protein binding, nuclei, Nf2 and IDBG-142996 and ENSMUSG00000009073 and 18016, NF2 and IDBG-636202 and ENSBTAG00000013153 and 540479
-
Gene info
-
Identity
-
Gene
-
Long gene nameNF2, moesin-ezrin-radixin like (MERLIN) tumor suppressor
-
Synonyms gene name
- neurofibromin 2 (bilateral acoustic neuroma)
- neurofibromin 2 (merlin)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1992-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- FERM domain containing
- A-kinase anchoring proteins
-
VEGA ID
-
Locus Specific Databases