SERPINB9 cloning plasmid

• Catalog number
  CSB-CL021077HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SERPINB9 gene.
• Specifications
  Gene name: SERPINB9; Gene ID: 5272; Accession number: BC002538; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1131; Sequence: atggaaactctttctaatgcaagtggtacttttgccatacgccttttaaagatactgtgtcaagataacccttcgcacaacgtgttctgttctcctgtgagcatctcctctgccctggccatggttctcctaggggcaaagggaaacaccgcaacccagatggcccaggcactgtctttaaacacagaggaagacattcatcgggctttccagtcgcttctcactgaagtgaacaaggctggcacacagtacctgctgagaacggccaacaggctctttggagagaaaacttgtcagttcctctcaacgtttaaggaatcctgtcttcaattctaccatgctgagctgaaggagctttcctttatcagagctgcagaagagtccaggaaacacatcaacacctgggtctcaaaaaagaccgaaggtaaaattgaagagttgttgccgggtagctcaattgatgcagaaaccaggctggttcttgtcaatgccatctacttcaaaggaaagtggaatgaaccgtttgacgaaacatacacaagggaaatgccctttaaaataaaccaggaggagcaaaggccagtgcagatgatgtatcaggaggccacgtttaagctcgcccacgtgggcgaggtgcgcgcgcagctgctggagctgccctacgccaggaaggagctgagcctgctggtgctgctgcctgacgacggcgtggagctcagcacggtggaaaaaagtctcacttttgagaaactcacagcctggaccaagccagactgtatgaagagtactgaggttgaagttctccttccaaaatttaaactacaagaggattatgacatggaatctgtgcttcggcatttgggaattgttgatgccttccaacagggcaaggctgacttgtcggcaatgtcagcggagagagacctgtgtctgtccaagttcgtgcacaagagttttgtggaggtgaatgaagaaggcaccgaggcagcggcagcgtcgagctgctttgtagttgcagagtgctgcatggaatctggccccaggttctgtgctgaccaccctttccttttcttcatcaggcacaacagagccaacagcattctgttctgtggcaggttctcatcgccataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SERPINB9   cloning  
• Gene symbol
  SERPINB9
• Short name
  SERPINB9 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  serpin peptidase inhibitor, clade B (ovalbumin), member 9 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  serpin peptidase inhibitor, clade B (ovalbumin), member 9, CAP-3 and CAP3 and PI-9 and PI9, SERPINB9 and IDBG-56650 and ENSG00000170542 and 5272, cysteine-type endopeptidase inhibitor activity involved in apoptotic process, nuclei, SERPINB9 and IDBG-636797 and ENSBTAG00000031267 and 524513

Gene info

• Identity
  HGNC:8955
• Gene
  SERPINB9
• Long gene name
  serpin family B member 9
• Synonyms gene
  • PI9
• Synonyms gene name
  • serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9
  • serpin peptidase inhibitor, clade B (ovalbumin), member 9
• Synonyms
  • CAP3
• Synonyms name
  • cytoplasmic antiproteinase 3
• GenBank acession
  • L40378
• Locus
  6p25.2
• Discovery year
  1995-07-21
• Entrez gene record
  5272
• Pubmed identfication
  • 8530382
  • 9858835
  • 24172014
• Classification
  • Serpin peptidase inhibitors
• VEGA ID
  OTTHUMG00000014131

Similar products