BCL10 cloning plasmid

• Catalog number
  CSB-CL002608HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the BCL10 gene.
• Specifications
  Gene name: BCL10; Gene ID: 8915; Accession number: BC053617; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 702; Sequence: atggagcccaccgcaccgtccctcaccgaggaggacctcactgaagtgaagaaggacgccttagaaaatttacgtgtatacctgtgtgagaaaatcatagctgagagacattttgatcatctacgtgcaaaaaaaatactcagtagagaagacactgaagaaatttcttgtcgaacatcaagtagaaaaagggctggaaaattgttagactacttacaggaaaacccaaaaggtctggacacccttgttgaatctattcggcgagaaaaaacacagaacttcctgatacagaagattacagatgaagtgctgaaacttagaaatataaaactagaacatctgaaaggactaaaatgtagcagttgtgaaccttttccagatggagccacgaacaacctctccagatcaaattcagatgagagtaatttctctgaaaaactgagggcatccactgtcatgtaccatccagaaggagaatccagcacgacgccctttttttctactaattcttctctgaatttgcctgttctagaagtaggcagaactgaaaataccatcttctcttcaactacacttcccagacctggggacccaggggctcctcctttgccaccagatctacagttagaagaagaaggaacttgtgcaaactctagtgagatgtttcttcccttaagatcacgtactgtttcacgacaatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  BCL10   cloning  
• Gene symbol
  BCL10-AS1, BCL10
• Short name
  BCL10 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  B-cellular CLL/lymphoma 10 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  B-cell CLL/lymphoma 10, c-E10 and CARMEN and CIPER and CLAP and mE10, BCL10 and IDBG-100044 and ENSG00000142867 and 8915, NF-kappaB binding, nuclei, Bcl10 and IDBG-198751 and ENSMUSG00000028191 and 12042, BCL10 and IDBG-637289 and ENSBTAG00000013851 and 540824

Gene info

• Identity
  HGNC:55868
• Gene
  BCL10-AS1
• Long gene name
  BCL10 antisense RNA 1
• Locus
  1p22.3
• Discovery year
  2021-09-06
• Entrez gene record
  646626
• Classification
  • Antisense RNAs

Gene info

• Identity
  HGNC:989
• Gene
  BCL10
• Long gene name
  BCL10 immune signaling adaptor
• Synonyms gene name
  • B cell CLL/lymphoma 10
  • BCL10, immune signaling adaptor
• Synonyms
  • CARMEN
  • CIPER
  • mE10
  • c-E10
  • CLAP
• Synonyms name
  • CARD-like apoptotic protein
  • CARD-containing apoptotic signaling protein
  • CARD containing molecule enhancing NF-kB
  • caspase-recruiting domain-containing protein
  • CARD-containing proapoptotic protein
• GenBank acession
  • AJ006288
• Locus
  1p22.3
• Discovery year
  1999-01-08
• Entrez gene record
  8915
• Pubmed identfication
  • 9989495
• RefSeq identity
  • NM_003921
• Classification
  • CBM complex
  • Caspase recruitment domain containing
• VEGA ID
  OTTHUMG00000009965
• Locus Specific Databases
  • LRG_1210

Similar products