RAB3D cloning plasmid
-
Catalog numberCSB-CL019197HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAB3D gene.
-
SpecificationsGene name: RAB3D; Gene ID: 9545; Accession number: BC016471; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 660; Sequence: atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgatttcaaggtcaagaccgtctaccgccatgacaagaggatcaagctgcagatctgggacacagcgggccaggagcgctaccgcaccatcaccacggcctactaccggggagccatgggcttcctgctcatgtatgacatcgccaatcaggaatcctttgccgctgtgcaggactgggccacgcaaatcaagacctactcctgggacaacgcccaggtcatcctggtggggaacaagtgtgacctggaggacgaacgtgttgtgcctgctgaggatggccggaggctcgccgacgaccttggtttcgagttctttgaagccagtgccaaggagaacatcaatgtgaagcaggtcttcgagcgcctggtggatgtcatctgcgagaagatgaacgagtccctggaacccagctccagctcaggcagcaacgggaaaggcccggccgtgggggatgctccagccccccagcccagcagctgcagctgctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAB3D
-
Short nameRAB3D cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRAB3D, member RAS oncogene family cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRAB3D, member RAS oncogene family, D2-2 and this GO V and RAB16 and RAD3D, RAB3D and IDBG-29123 and ENSG00000105514 and 9545, GTPase binding, nuclei, Rab3d and IDBG-142093 and ENSMUSG00000019066 and 19340, BT.20052 and IDBG-643511 and ENSBTAG00000002148 and 100139105
-
Gene info
-
Identity
-
Gene
-
Long gene nameRAB3D, member RAS oncogene family
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-06-02
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- RAB, member RAS oncogene GTPases
-
VEGA ID