RAB3D cloning plasmid

• Catalog number
  CSB-CL019197HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the RAB3D gene.
• Specifications
  Gene name: RAB3D; Gene ID: 9545; Accession number: BC016471; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 660; Sequence: atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgatttcaaggtcaagaccgtctaccgccatgacaagaggatcaagctgcagatctgggacacagcgggccaggagcgctaccgcaccatcaccacggcctactaccggggagccatgggcttcctgctcatgtatgacatcgccaatcaggaatcctttgccgctgtgcaggactgggccacgcaaatcaagacctactcctgggacaacgcccaggtcatcctggtggggaacaagtgtgacctggaggacgaacgtgttgtgcctgctgaggatggccggaggctcgccgacgaccttggtttcgagttctttgaagccagtgccaaggagaacatcaatgtgaagcaggtcttcgagcgcctggtggatgtcatctgcgagaagatgaacgagtccctggaacccagctccagctcaggcagcaacgggaaaggcccggccgtgggggatgctccagccccccagcccagcagctgcagctgctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  RAB3D   cloning  
• Gene symbol
  RAB3D
• Short name
  RAB3D cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  RAB3D, member RAS oncogene family cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  RAB3D, member RAS oncogene family, D2-2 and this GO V and RAB16 and RAD3D, RAB3D and IDBG-29123 and ENSG00000105514 and 9545, GTPase binding, nuclei, Rab3d and IDBG-142093 and ENSMUSG00000019066 and 19340, BT.20052 and IDBG-643511 and ENSBTAG00000002148 and 100139105

Gene info

• Identity
  HGNC:9779
• Gene
  RAB3D
• Long gene name
  RAB3D, member RAS oncogene family
• Synonyms gene
  • GOV
• Synonyms
  • RAB16
  • D2-2
  • RAD3D
• Synonyms name
  • Rab3D upregulated with myeloid differentiation
  • glioblastoma overexpressed
• GenBank acession
  • AF081353
• Locus
  19p13.2
• Discovery year
  1999-06-02
• Entrez gene record
  9545
• Pubmed identfication
  • 10023084
  • 10072586
• RefSeq identity
  • NM_004283
• Classification
  • RAB, member RAS oncogene GTPases
• VEGA ID
  OTTHUMG00000180835

Similar products